1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
3 years ago
15

If a yellow shirt is under green light what color would the shirt be?

Biology
1 answer:
wel3 years ago
3 0

Answer:

the colour of the shirt would be green

You might be interested in
Which is a basic characteristic of all living cells?
slamgirl [31]
Growth and the ability to create more of itself.
7 0
4 years ago
Read 2 more answers
With the mapping of the human genome and the development of karyotypes to predict genetic abnormalities, there is a growing need
Butoxors [25]

Answer: <u><em>Human Genetic Variation</em></u>

7 0
3 years ago
The thoracic and sacral curvatures of the vertebral column are ________ while the cervical and lumbar curvatures are
Crazy boy [7]

Answer:

The thoracic and sacral curvatures of the vertebral column are <u>convex</u> while the cervical and lumbar curvatures are <u>concave.</u>

7 0
3 years ago
ANATOMY QUESTION URGENT
KiRa [710]
Loss of flexibility and loss of strength
4 0
4 years ago
Read 2 more answers
CH2OH is what type of monosaccharide
shusha [124]

Answer:

CH2OH is the chemical formula of methanol. It is not a monosaccharide. According to the definition, monosaccharides are the simplest form of sugar; they cannot be further hydrolzed to yield simple sugar molecule. Its degradation will produce simple inorganic molecules such as H2O or CO2 but not any sugar molecule.

4 0
4 years ago
Other questions:
  • What is this ???? Who will solve it ?? Solve it quickly
    7·1 answer
  • How are menopause and the climacteric related?
    12·1 answer
  • How many liters are equivalent to 150 dekagrams
    15·1 answer
  • How is an individual palm tree growing in a tropical forest classified?
    15·2 answers
  • Which of the following factors interact to create currents that are less than 50 m deep?
    11·2 answers
  • How are acids and bases different? how do their pH values differ?
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following is a living factor in an ecosystem that could limit the size of a raccoon population?
    5·2 answers
  • Which basic function of life is exemplified when a single-celled organism uses its eyespot to sense light?
    6·1 answer
  • Which type of population pyramid occurs in locations where fertility rates are high, death rates fall, and more people
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!