1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
4 years ago
14

How do rates of mutation "power" molecular clocks?

Biology
1 answer:
stepladder [879]4 years ago
8 0
Molecular clocks use rates of mutation to measure evolutionary time.Mutations add up at a fairly constant rate in the DNA of species that evolved from a common ancestor. The more mutations that happened in each lineage, the greater is the differences between these lineages.
You might be interested in
Birth rate = 35
serg [7]
Population decreases by 15.

Birth rate means more population (positive), death rate means less population (negative), immigration means more (positive), and emigration means less (negative).  So, just add and subtract the appropriate numbers:

35\ people\ born-7\ people\ die+4\ people\ enter-17\ people\ leave=\\-15\ people

Negative 15 people means that the population decreases by 15.
6 0
3 years ago
Which of these is an advantage of hydroelectric energy
marishachu [46]

Answer:

B. reduce greenhouse gas emissions

Explanation:

The hydroelectric energy has its pros and cons as most of the energy production facilities do. One of the biggest advantages of the production of this type of energy is that it almost doesn't emit any greenhouse gases into the atmosphere. Considering the problem that the world is facing because of it, especially the climate changes and rising sea levels because of that, this is seen as a very big plus for any type of energy production. This has resulted in the building of more and more dams that produce hydroelectric energy, some of which have been made very large and very large energy production.

8 0
4 years ago
How many different DNA sequences of 32 bases can you have if there is unlimited availability of all bases
Annette [7]

we have 4 different bases: Adenine(A) thymine(T) cytosine(C) and guanine(G)

We have combinations 32 taken 4

written as 32C4=32!/4!(32-4)!=32!/4!*28!=29*30*31*32/24=35960

8 0
4 years ago
Put these processes of the water cycle in the correct order, starting from the moment the sun transfers it's energy
Volgvan

is there any choices?

6 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Dog vs Human Anatomy
    10·1 answer
  • Which statement describes Mendel’s hypotheses regarding gametes?
    13·2 answers
  • Phospholipids form the main fabric of the plasma membrane. one feature of phospholipids is that when they are placed in an aqueo
    7·2 answers
  • What do lysosomes produce that are essential to their function? A. proteins B. ribosomes C. transport vesicles D. digestive enzy
    10·1 answer
  • A kitten has mostly gray fur, but patches of white fur form around its eyes, ears, and belly. The two parents of the kitten do n
    11·1 answer
  • Can anyone help me?
    11·1 answer
  • Why is pH important in the human body?
    11·2 answers
  • In a zoo located in a warm region, which should be included in the polar bear exhibit?
    14·2 answers
  • How does exercise affect a person's body and homeostasis?
    15·1 answer
  • In chickens, the allele for black feathers (A) is dominant over the allele for red feathers (a).
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!