Population decreases by 15.
Birth rate means more population (positive), death rate means less population (negative), immigration means more (positive), and emigration means less (negative). So, just add and subtract the appropriate numbers:
Negative 15 people means that the population decreases by 15.
Answer:
B. reduce greenhouse gas emissions
Explanation:
The hydroelectric energy has its pros and cons as most of the energy production facilities do. One of the biggest advantages of the production of this type of energy is that it almost doesn't emit any greenhouse gases into the atmosphere. Considering the problem that the world is facing because of it, especially the climate changes and rising sea levels because of that, this is seen as a very big plus for any type of energy production. This has resulted in the building of more and more dams that produce hydroelectric energy, some of which have been made very large and very large energy production.
we have 4 different bases: Adenine(A) thymine(T) cytosine(C) and guanine(G)
We have combinations 32 taken 4
written as 32C4=32!/4!(32-4)!=32!/4!*28!=29*30*31*32/24=35960
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
