1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
9

Please help I’m being timed and please no links

Biology
2 answers:
BabaBlast [244]3 years ago
7 0

Answer:

A

Explanation:

Greenhouse gases in the atmosphere may increase.

vlada-n [284]3 years ago
4 0
I would think A I’m not sure
You might be interested in
The Punnett square shows a cross between two parents. The allele (H) represents the mutated gene that causes Huntington’s diseas
Lelu [443]

Answer:

The disease is autosomal dominant.

Explanation:

Huntigton's disease is an autosomal dominant disease because the allele for this disease is present on an autosomal chromosome and the person with even one mutated allele (H) can develop the disease even if he has one normal allele (h) too. If a person is affected with Huntigton's disease, there are 50 percent chances that the children will also suffer from the disease.


For example: A father is suffering from Huntigton's disease but mother is normal. Let us see how it will be passed to kids.


P1:                                   Hh :           hh

Gametes:                         H :         h:      h:       h

Offspring:                         Hh:       Hh:      hh:        hh

                                               50%        :       50%

Therefore, 50 percent chances are there that the kids will have disease even if only parent suffers from it.

8 0
4 years ago
A skeletal muscle is a composition of several components bundled one into the other. at which structural level in the muscle doe
Alexandra [31]

The structural level in which the muscle produces the contraction is known as the muscle fiber.

<h3>What is a muscle fiber?</h3>

A muscle fiber is a single muscular cell that is able to contract by using specialized proteins such as filaments of myosin and actin.

This unit (muscle fiber) is able to contract both in vivo and in vitro by establishing suitable environmental conditions (e.g., proper calcium levels).

In conclusion, the structural level in which the muscle contracts is the muscle fiber.

Learn more about muscle fibers here:

brainly.com/question/27960158

#SPJ1

8 0
2 years ago
PLZZZZZZ HELPPP how do we obtain energy from wind
yawa3891 [41]

Answer:

Wind Turbind

Explanation:

7 0
3 years ago
Read 2 more answers
Oxygen and carbon oxide pass through the plasma membrane by _______
lisabon 2012 [21]

Carbon dioxide and oxygen are two molecules that undergo this simple diffusion through the membrane. The simple diffusion of water is known as osmosis. hope this maybe helps :3

3 0
4 years ago
When one dna molecule is copied to make two dna molecules, each new dna molecule contains: 25% of the parent dna. 50% of the par
diamong [38]
Each new dna molecule contains: 50% of the parent dna.
8 0
4 years ago
Other questions:
  • Which one goes to the right one
    6·1 answer
  • Approximately 25% of the F2 offspring from Mendel's second set of
    9·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Mary has a type blood. her son bill has type ab blood which blood types does bills dad have if he is homozygous for blood type?
    10·1 answer
  • Factors That Affect Climate
    14·2 answers
  • Although experiencing severely traumatic events may lead to PTSD, it is also likely to lead to
    15·2 answers
  • If organisms are energy deprived (ie given no food, nutrients or light) indoors at 23°C for 24 hours and they
    7·1 answer
  • A trait that occurs in 900 individuals out of a total of 1,800 individuals occurs with a probability of
    11·1 answer
  • Which of the following accurately contrasts conventional tillage and conservation tillage?
    9·1 answer
  • SOMONE PLS HELP MEEEEEE :(<br> its for science but it says biology since science isn't an option
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!