Answer:
The wheel and axle is a machine consisting of a wheel attached to a smaller axle so that these two parts rotate together in which a force is transferred from one to the other.
Answer:
<h3>The conversion of molecule into phosphate .......</h3>
follow me and mark me brainliest
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Oxygen is transported throughout the by binding with Hemoglobin that is present in the Red Blood Cells.
Hope it helps :)
Answer: The head loves water (hydrophilic) and the tails hates water
Explanation:
please give me brainliest.