1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
3 years ago
8

Help plz! will give brainliest!

Biology
2 answers:
Phantasy [73]3 years ago
6 0

Answer:

<h3>in air its faster with 16,700 steel second fastest 16,410 water third fastest with 4,629 and lastly air 1,127</h3>

Masja [62]3 years ago
4 0

Answer:

in air its faster with 16,700 steel second fastest 16,410 water third fastest with 4,629 and lastly air 1,127

Explanation:

what i just said

You might be interested in
Identify the role of carbon dioxide in photosynthesis.
VashaNatasha [74]
It acts like its nothing there .
6 0
3 years ago
Which of the following describes the main role of the electron transport chain in cellular respiration?
Lapatulllka [165]

Answer:

A.it pumps hydrogen ions inside the cell

Explanation:

Principally, the main role of electron transport chain is to maintain the electrochemical gradient of hydrogen ions (H+) inside the mitochondrial matrix. This is the last step in aerobic cellular respiration and performs a series of redox reactions. Overall, it allows accumulation of H+ inside the mitchondrial matrix. This increased gradient or accumulation of hydrogen ions (H+) is essential because H+ would accept the electrons producing during the reactions. Without this, the flow of electron will be stopped because of high  gradient, and production of ATP will not happen as well.

Indeed ETC helps in production of ATP but that is not the main function of electron transport chain rather it is a function of mitochondria.

3 0
3 years ago
Read 2 more answers
____ during the late Carboniferous caused changes in plants and terrestrial animals.
Oxana [17]

The answer is “glaciations”. In the late Carboniferous period there was a significant climate change all over the world that caused mass glaciations and it resulted in a huge number of species to become extinct

4 0
3 years ago
Which of these is true for a fetus by the end of the first trimester of fetal
Jet001 [13]

Answer:

the answer is A :)!!!!!!!!!

6 0
3 years ago
The Atmosphere is the shell of gasses that surround the Earth and is layered
Setler79 [48]

Answer:

I would say true, because

Explanation:

Earth's atmosphere has a layered structure. From the ground toward the sky, the layers are the troposphere, stratosphere, mesosphere, thermosphere, and exosphere. Another layer, called the ionosphere, extends from the mesosphere to the exosphere. Beyond the exosphere is outer space.

7 0
3 years ago
Other questions:
  • \Which of the following is the BEST term for the set of cell processes used to make ATP for energy in the presence of oxygen?
    5·2 answers
  • How do you calculate the eccentricity of an ellips?
    15·1 answer
  • A physically fit 86-year-old is scheduled for right knee replacement. which factor the client at increased risk for complication
    14·1 answer
  • Evaluate the analogy of tropical rain forests being referred to as the "lungs" of earth.
    6·1 answer
  • Liver tissue is a combination of many types of cells. In addition to other tissues, it contains connective tissue and epithelial
    7·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Drugs are substances that cause a change in a persons physical not mental state
    12·2 answers
  • Which best describes what solar systems are comprised of? stars, planets, moons, asteroids, and comets galaxies universes planet
    5·1 answer
  • Which structure performs photosynthesis in plant cells but is not present in animal cells?
    7·1 answer
  • How would you explain why bicarbonate and digestive enzymes respond differently in two of the variables in Figure 30–8?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!