1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
satela [25.4K]
3 years ago
11

In chlorophyll b functional group is?

Biology
1 answer:
Ipatiy [6.2K]3 years ago
4 0

Answer:

Aldehyde group

Explanation:

The two chlorophylls differ only at position 3 (ring B): chlorophyll a contains a methyl group at this position, whereas chlorophyll b contains an aldehyde group (1).

You might be interested in
A group of similar cells that perform a common function
Alchen [17]

Answer:

Tissue

Tissue is the group of similar cells that are common in origin to perform particular function. Tissue system is the group of similar tissues that are common in origin and perform particular function. Organs are made up of tissue system.

Explanation:

4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
⦁ In what stage of an animal’s life cycle do most cells differentiate?
Ber [7]

Answer:

Reproduction

Explanation:

4 0
2 years ago
Read 2 more answers
If the government wants to reduce the burning of fossil fuels, it should impose a tax on a. sellers of gasoline. b. either buyer
Kitty [74]

The correct answer is "either buyers or sellers of gasoline"

Explanation:

The best way to significatively reduce the use of fossil fuels is to tax on both sellers and consumers. Moreover, it also becomes necessary to promote policies associated with the use of alternative energy sources and to subsidize its use

5 0
3 years ago
Read 2 more answers
A customer is looking at a new desktop computer. To energize your
Gnesinka [82]

Answer:

List the features of the computer

6 0
3 years ago
Other questions:
  • A nursing student has been assigned to care for a client with digeorge syndrome. the student has reviewed the clinical manifesta
    9·1 answer
  • The _______________ pathway of RNA interference is a result of double stranded DNA entering a eukaryotic cell. The _____________
    15·1 answer
  • How do the male and female reproduction systems contribute to the formation of offspring?
    9·2 answers
  • 1 teaspoon of sugar provides 4 g of carbohydrates and about __ kcalories
    10·2 answers
  • Graphical representation of vectors involves​
    11·1 answer
  • Ricky observed this organism under the microscope.
    5·1 answer
  • What organ does NOT belong in the nervous system? Provide a small explanation from the internet.
    14·2 answers
  • What other body systems are related to the digestive system
    11·1 answer
  • Why postharvest physiology is important to maintain sustainable food supply on this planet. Please give named examples and discu
    8·1 answer
  • With sleep deprivation, the levels of leptin __with sleep deprivation, the levels of leptin ________ and the levels of ghrelin _
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!