1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
9

Chloroplasts require oxygen. True Or False??

Biology
1 answer:
ANTONII [103]3 years ago
4 0

Answer:

yes true because  The oxygen released by the chloroplasts is the same oxygen you breathe every day.

Explanation:

You might be interested in
An animal’s __________ is an immediate automatic response to an external stimulus.
guajiro [1.7K]
It could be reflex or instinct, most likely reflex
7 0
3 years ago
What is (are) the target organ(s) of a gonadotropin?
zepelin [54]
An anterior pituitary gland
3 0
4 years ago
Answersamoeba sisters: video recap mitosis: the amazing cell process that uses division to multiply amoeba sisters video recap o
7nadin3 [17]

1.Mitosis is done by your body cells. What types of cells do not undergo mitosis?

Sperm cells and egg cells do not undergo mitosis. They undergo a different process of cell division called meiosis. The difference between the two types of cell division is that mitosis result in a replication of the parent cell or identical cells. Meiosis contributes to genetic variety, meaning the resulting cells are different from the parent cell in some way.

2.Describe  ways that mitosis is important for your body.

Mitosis is important for growth. Mitosis creates new cells as you grow. If you think about it, where do we get all the extra skin, longer bones, longer hair—they result from the division of cells which create new cells.

Another way it is important is in repair. When you get a cut for example, mitosis helps by producing more cells to repair the gash that was left. New cells fill in the part that was cut. Mitosis also helps with replacing worn out cells.

3. This illustration is trying to demonstrate something that mitosis is not. In mitosis, the cells that are created are identical.

The illustration shows that one type of cell produces a different type, but it is not the case with mitosis. The resulting cells of this type of cell division is identical or twins.

4.Mitosis is just one small part of the cell cycle! Describe what would occur if cells were in mitosis more than they were in interphase.

Interphase makes up most of the cell cycle, it makes up about 90% and mitosis occurs in 10% of the whole cycle.  If cells were in mitosis more than they were in interphase that would indicate an uncontrollable and rapid growth of cells and you can get cancer.

5.When cells are dividing, it is important to understand that they have to move chromosomes equally to both cells. Based on this illustration, describe what a chromosome is made of.

Chromosomes are condensed units found in the nucleus. There are 46 chromosomes each nucleus, or each cell. Chromosomes are made up of protein and DNA. DNA stands for deoxyribonucleic acid and it carries genetic information.

6. In humans, there are 46 chromosomes. They are duplicated during interphase, which in turn duplicates the DNA as well. Chromosomes are counted based on the number of centromeres. The number of chromosomes in living organisms or species differ from each other.  

6 0
3 years ago
Read 2 more answers
There are stretch receptors in the aorta and carotid arteries, and they are stimulated when blood pressure falls. If blood press
qaws [65]
C) I and III only just got this question on usa test prep and therefore i'm right 
7 0
3 years ago
Why is it important to define what a living thing is?
natali 33 [55]

Answer:

So people know that everything has a value and they should appreciate it.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Explain your results in terms of the endocrine system. indicate how the endocrine system is involved in the physiological respon
    5·1 answer
  • What best describes a tetrad
    5·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How are animal and plant cells alike and different?
    12·1 answer
  • Which of the following statements accurately describes the process of dating Earth's history?
    11·2 answers
  • If a star appears to be very red (like Betelgeuse), it is likely to be in which spectral class? O A G M
    6·2 answers
  • Please briefly share the influences on your decision to pursue the field of medicine, including shadowing experiences and other
    14·1 answer
  • 1. Which statement about the current U.S. Supreme
    14·1 answer
  • Which of these presents an ethical issue associated with genetic testing on humans?
    9·2 answers
  • The ability to categorize data can be described as “discernment”<br><br> true or false ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!