Answer:
The results are useless
Explanation:
The alkaline/alkaline results could indicate that only the protein was utilized by the organism, but it could also be a result of prolonged incubation. The organisms could have exhausted that available sugar and then reverted to protein catabolism.
Answer:
cause cells to shrink due to an increase in the osmolarity of extracellular fluid.
Explanation:
Normovolemic describes the situation in which a living organism maintains a normal volume or amount of blood in the body.
A hyperosmotic solution can be defined as a solution having an increased level of osmotic pressure. Thus, when there's a greater amount of solute with respect to another solution in a membrane with close similarities, it is known as hyperosmotic solution.
Basically, hyperosmotic solution gives rise to higher difference between solutes and similar solutions.
Hence, when a normovolemic person consumes a large quantity of a hyperosmotic solution, it will cause cells to shrink due to an increase in the osmolarity of extracellular fluid i.e the total number of solute particles with respect to the concentration of a solution (Osm/L).
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
For number 1 the first arrow is the cell wall, the second is the membrane, and the last arrow would be the cytoplasm
For number 2 they are in distilled water Bc they are remaining the same and not shrinking up
For three draw the cells smaller salt water sucks the water out of them
For four they get smaller because the salt has a higher concentration making the water leave the cell. Once water has left the cell begins to shrink
Answer: Stages of mitosis: prophase, metaphase, anaphase, telophase.
Explanation: UR welcome
