1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
9

Conclusion

Biology
2 answers:
katovenus [111]3 years ago
6 0
10 and 2 have a great day
Maslowich3 years ago
5 0

Answer:

10 different species are shown in the picture

2 different genus groups are classified on this picture

Hope this helps

You might be interested in
What is base ? what is acid and salts? plz explantion this question
Dvinal [7]

Explanation:

In acid – base chemistry, salts are ionic compounds that result from the neutralization reaction of an acid and a base. Basic salts contain the conjugate base of a weak acid, so when they dissolve in water, they react with water to yield a solution with pH greater than 7.0.

8 0
3 years ago
Read 2 more answers
What is a distinguishing characteristic of a saturated fatty acid
gulaghasi [49]

Answer: Single covalent bond in the long hydrocarbon chain.

Saturated fatty acids are long chains of hydrocarbon ( with single covalent bond) ending with the carboxylic group (-COOH). This means those fatty acids which possess only single bonds in their chemical structure are called as saturated fatty acids. They are densely packed, which makes them solid at room temperature.  

Example- Lauric acid ( present in coconut oil). It has 12 carbon atoms in its chemical structure.

6 0
3 years ago
Read 2 more answers
What term describes an enzyme?
mina [271]
An enzyme is a biological molecule that acts as a catalyst in many reactions. They speed up chemical reactions especially the reactions inside living organisms. An enzyme is made up of amino acids. They are known to be very efficient catalysts. Hope this answers the question!
6 0
3 years ago
Read 2 more answers
3. When (what year) were stone tools first used?
Dima020 [189]
Stone tools we’re first used around 3,300 BCE
4 0
3 years ago
If you dont take care of your body who will...plz give real answers i really need help​
maksim [4K]
No one you need to take care of yourself sis
3 0
4 years ago
Read 2 more answers
Other questions:
  • A scientist is examining a single-celled organism that is often found in the human body; some examples of this organism are help
    10·2 answers
  • individuals with hiv sometimes contract secondary infections that ate rare in the rest of the population this is because people
    15·1 answer
  • A parasite is an organism that
    9·1 answer
  • The neurons of the central nervous system are also known as ________.
    9·1 answer
  • In which way is primary succession similar to secondary succession?
    5·1 answer
  • How will you describe the sequence of oxygen carbon dioxide and blood flow?
    5·1 answer
  • How do beavers dams help other animals and people? Fill in the inference in the chart.
    7·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • I NEED HELP ANSWER FAST
    13·1 answer
  • 48:11
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!