1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
6

As the amount of light received by this plant increases, its rate of photosynthesis HELP!!!!!!

Biology
1 answer:
Elis [28]3 years ago
5 0
D. Increases, then remains the same

As seen on the graph, the amount of photosynthesis rises and then maintains in a straight line, meaning it is staying the same. Hope that helps!!
You might be interested in
Mike earned scores of 88,91,75,and 72 on four math tests determine his score on the fifth test if his average for five tests was
My name is Ann [436]

Explanation : x = 79 marks

The marks scored by Mike on four math test are 88,91,75 and 72.

Average of marks, A = 81

Let in fifth test he scores x marks.

The formula for finding average is :

A=\dfrac{sum\ of\ scored\ marks}{no.\ of \ tests}

81=\dfrac{88+91+75+72+x}{5}

\dfrac{326+x}{5}=81

x=79

In the fifth test he scores 79 marks.

Hence, this is the required solution.

4 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which behavior is an instinct?
suter [353]

Answer:

D

Explanation:

A robin building a nest is not learned or taught like the others. It is just instinctive for robins to build nests.

8 0
3 years ago
Read 2 more answers
Choose all the answers that apply.
Galina-37 [17]
A. cycles B. equilibrium C. change D. models E. scientific method
all these would be found in science.
7 0
3 years ago
Read 2 more answers
What is an example of a prokaryotic cell?
erastova [34]

Examples of prokaryotic cells include:

<span>bacteria
<span>algae</span></span>
7 0
3 years ago
Other questions:
  • Genomic libraries can be constructed using bacterial plasmids or what other vector?
    9·1 answer
  • The circulation of blood to all organs of all the systems of the body is known as
    15·1 answer
  • Enzymes, such as the one shown in the picture, work by fitting onto the substrate molecule like a lock-and-key action. Which sta
    8·2 answers
  • For most ecosystems __________ is (are) the ultimate source of energy, and energy leaves the ecosystem in the form of __________
    11·1 answer
  • Evan's nightly chores include washing dishes. His mother cooks everything she prepares a bit too long. Because of this, Evan spe
    8·1 answer
  • How many appendages does a termite have?
    6·1 answer
  • Define what it means to be a hybrid plant
    13·2 answers
  • Cellular Respiration is mainly about the release of what?
    10·2 answers
  • Proteins in the cell membrane that identify the cell are called what
    5·1 answer
  • Target organs regulate the pituitary through feedback loops. Most often, this takes the form of
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!