<span>The nurse should tell the parents to record what the child eats and drinks on a daily basis. This strategy will allow the nurse to see how the food and drinks the child consumes effects her condition. With the record the nurse will be able to suggest foods that will help the child be able to handle her disability better.</span>
33% is the unknown concentration of the tube.
Explanation:
Concentration of stock of windex = 50%
concentration of bacteria = 500 microliter
nutrient broth = 1000 micro litre +500 microlitre of windex
concentration of bacteria is the volume of bacteria present in nutrient broth culture.
total volume in the tube is 1000
50% is the concentration of tube of bacteria and broth before adding windex.
After adding windex of 50 % concentration and the volume is 500 microliter which is only 250 microliter of windex rest is water.
33% is the concentration of the tube, which means it has 33% of bacteria in 1500 ml of solution.
C) oak trees.....................................................................................srry needed 20 characters.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: