1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FrozenT [24]
3 years ago
6

Why do you think the water, oil, and gas are found in layers?

Biology
1 answer:
geniusboy [140]3 years ago
5 0

Answer:

<h2>The source rock is the rock that contains the kerogen that the oil and gas forms from. The reservoir rock is the porous, permeable Rock layer or layers that hold the oil and gas. This migration occurs because oil and gas are less than than water.</h2>
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
The science of studying the entire collection of mRNA molecules produced by cells, allowing scientists to monitor differences in
ch4aika [34]

Answer:

Transcriptomics.

Explanation:

Transcriptomics may be defined as the field of biology that mainly deals with the study and collection of the mRNA molecules. Various techniques like DNA microarray and exon shuffling is used in transcriptomics.

Messenger RNA molecule are collected from the source that are produced by the cells. Transcriptomics helps the scientist to determine the similarities and differences in the gene expression pattern between the different cells.

Thus, the correct answer is option (2).

8 0
3 years ago
In the savanna, many animals have adapted a ___________ pattern in which they follow the water and food supply.
irina1246 [14]

Answer:

The answer is migration.

7 0
3 years ago
Which statement is an example of a scientific theory? A. The amount that caffeine affects a person's heart rate differs based on
nadya68 [22]

Answer:

Pretty sure it's A because people can redo this test as many times as needed to verify the answer.

5 0
3 years ago
Read 2 more answers
Summarize the facts about Huntington's disease by completing the concept map below.​
hram777 [196]

Answer:

There is no effective cure.

the disease is caused by a single defective gene on chromosome 4.

the disease causes a breakdown of nerve cells in the brain.

as early as age 2 or as late as 80. but usually 30 and 50.

molecular analysis, i don't know the last words sorry

3 0
3 years ago
Other questions:
  • Which best describes the greenhouse effect? A. Solar radiation is transferred to the oceans. B. Solar radiation is blocked from
    15·2 answers
  • Which feature or property of water allows plants to draw liquid water up from their roots? Water heats up and releases heat slow
    7·2 answers
  • What does a food chain always start with
    12·1 answer
  • A substance with a hardness of 8 will scratch a substance with a hardness of 7.
    15·2 answers
  • Which atom is involved in giviiſig your heart energy to beat?
    11·1 answer
  • Help me!
    10·1 answer
  • One gene pair can influence other gene pairs, with their combined activities producing some effect on phenotype; this called ___
    15·1 answer
  • How do you think the rabbit population affected the fox population over the same ten-year period. Explain your reasoning.
    13·1 answer
  • How is cellular respiration and photosynthesis linked to specific organelles within the eukaryotic cells?
    14·2 answers
  • Helppppppppppppppppp
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!