1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
3 years ago
11

What is used to pass exciting electrons in the thylakoid membrane?

Biology
1 answer:
Minchanka [31]3 years ago
6 0

Answer:

Photosystem I, however, does not act as a proton pump; instead, it uses these high-energy electrons to reduce NADP+ to NADPH. The reaction center chlorophyll of photosystem I transfers its excited electrons through a series of carriers to ferrodoxin, a small protein on the stromal side of the thylakoid membrane.

Explanation:

You might be interested in
What is the difference between sleet and hail? What conditions are needed to make each?
Furkat [3]

Answer:

Sleet forms in winter storms, while hail is a warm-season type of precipitation. As noted above, sleet forms when snow melts in a warm layer and then refreezes into ice pellets as it falls though a cold layer. Hail, however, forms in spring, summer or fall thunderstorms.

Explanation:

I put this question before and got this one so I think it will be this answer. Hope this helps. :)

6 0
3 years ago
What determines which stage occurs after a supernova?
ch4aika [34]
The mass of the star actually determines the stage of the star after supernova. If the mass of the star is small, then it would become a very small and dwarf, cold and dead body in space. The mass of the star has to be less than that of the sun. If the mass of the star is greater than sun, then it would become a black hole. The mass of the star has to be more than 1.4 times the mass of the sun to become a black hole.



7 0
3 years ago
I need this one quick for a timed assignment:
Sindrei [870]

Answer:

the answer is B

Explanation:

3 0
3 years ago
Which best describes the nucleus of an atom?
Naily [24]

Answer:

A. It is the most massive part of the atom.

5 0
3 years ago
How the conditions on early earth made the origin of life possible?
kiruha [24]
Water, air, food. and heat.
7 0
4 years ago
Other questions:
  • What is the most famous piece of art in the prado museum
    10·1 answer
  • What bone does not articulate directly with any other bone?
    8·1 answer
  • Which of the following is the correct definition of nuclear energy?
    8·1 answer
  • Fat around organs______ Phospholipids_____ Hormones in the bloodstream______ Fat under the skin______
    15·1 answer
  • Thread like tubes forming the body of a fungus are called what?
    5·1 answer
  • Describe a procedure that you would use to localize the protein dynein
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Give the quantitative values for Earth's species diversity, and compare biodiversity across
    5·1 answer
  • Two lizards with different coloring exist within the same ecosystem. One lives in the trees, and the other prefers hiding among
    6·1 answer
  • In a cross between homozygous (pure) dominant yellow seed peas and green seed peas what proportion of the offspring would be exp
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!