1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
3 years ago
6

Ice wedging into the rock and breaking and crAcking the rock and soil

Biology
2 answers:
Makovka662 [10]3 years ago
7 0

Answer:

Ice wedging is a process that happens when water gets into the cracks of concrete, stones, other forms of the Earth, and freezes. When the water freezes, it expands and pushes the rock from the crack which either separates and turns it into two rocks, or the rock might form together again and just be a larger rock. This process happens in Winter and usually finished in Spring when the ice between the rocks melt. I have described the process of ice wedging for you.

Rzqust [24]3 years ago
4 0
Yes it’s called ice wedging you’re correct
You might be interested in
Design an experiment that determines the amount of time needed for a person’s heart rate to return to normal after exercise
Makovka662 [10]

Answer:

You could record yourself doing a cardio exercise such as running or using a jump rope for a certain period of time using a stop watch or a phone timer. Then stop after about 5-10 minutes and using the stop watch see how long it takes for your heart rate to go back to normal.

Explanation:

8 0
3 years ago
A section of DNA is shown below:
Alenkinab [10]
Answer c sieuejejejejje
3 0
3 years ago
What is diffusion in biology?
leonid [27]
Diffusion is the movement of a substance from an area of high concentration to an area of low concentration. Diffusion happens in liquids and gases because their particles move randomly from place to place. Diffusion is an important process for living things; it is how substances move in and out of cells
8 0
3 years ago
he birds shown above have beaks with three different shapes and sizes.these genetic variations in the black each appeared initia
faust18 [17]

Answer:

mutations

Explanation:

5 0
3 years ago
Read 2 more answers
What is the difference between plant and animal cells
mario62 [17]
On the structural difference, as basic animal cell has a nucleus , which contains genetic materials, a cytoplasm, which allows chemical reaction to occur, and a cell membrane, which can control which substance to go in or out from the cell.
meanwhile in plant cells, apart from all the same structures found in animal cells, it also has a vacuole, which contains dissolved substance, some chloroplasts, which is for photosynthesis, and also a cell wall too outside the cell membrane which can protect the plant cell from bursting
7 0
3 years ago
Other questions:
  • When reviewing an appropriate diet for a client with diabetes, the client expresses a dislike for sweet potatoes. what should th
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • How does the ratio of the two types of melanin you have affect your skin color?
    5·2 answers
  • What precautions should one use when working with phenacetin?
    10·1 answer
  • The hormone epinephrine binds to ß adrenergic receptors on smooth muscle cells of the bronchioles, causing them to dilate (incre
    11·2 answers
  • ¿Qué pasa con los materiales que llegan al intestino grueso(por no ser útiles o digeribles por nuestras células)? HeLp
    15·1 answer
  • What cell parts are common to What cell parts are found only in plant cells? What are found only in animal cells?
    6·2 answers
  • What would happen if the population of the bird species shown in the ecosystem above where to set lee decrease?
    14·1 answer
  • The sun contributes to photosynthesis by providing plants with
    14·1 answer
  • Do dinosaur prints become fossils
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!