Answer:
The genotypes found in the F2 offspring will be An1An1, An1An2 and An2An2.
Explanation:
In the example given in the question, the color of the petals of snapdragon flowers are given with the An1 allele having full activity and the An2 allele being the null allele. For the F1 offspring, two snapdragon flowers are crossed, one with red petals which is An1An1 and one with ivory petals which is An2An2. All the genotypes for the F1 offspring will result in An1An2.
Then using this F1 offspring, the F2 offspring is found and the genotype of the F2 offspring will be An1An1 / An1An2 / An1An2 / An2An2.
So the genotypes found in the F2 offspring will be An1An1, An1An2 and An2An2. One red petal snapdragon, 1 ivory snapdragon and 2 pink snapdragons.
I hope this answer helps.
My Answer: DNA cloning.
Hope I helped! :D
Tentacles of an octopus as well limbs of a lizard are analogous structures.
Analogous structures or organs perform the same function in different organisms that bear no resemblance to each other anatomically. Analogous structures are formed as a result of convergent evolution, i.e. different structures evolving for the similar function and thus having similarity. Tentacles of an octopus as well as limbs of a lizard are used for the similar function, i.e. locomotion in this case.
On the other hand, homologous structures result from divergent evolution. Homologous organs contain a similar basic structure but perform distinct functions in different organisms.
To learn more about Homologous organs here
brainly.com/question/14963404
#SPJ1
It would more likely to be pollinated by insects.
This is because the bright color of the petals can attract insects towards the flower thus sticking some pollen grains and transfer them to the stigma (female part of flower).
On the other hand, the color of petals do not really have effect on the wind pollination. Therefore this explains why wind pollinated flowers usually have small or dull colored petals.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
