1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
2 years ago
5

Flatworms are acoelomates. Which of the following statement supports this fact?. . . A. A flatworm doesn't have a coelom.. . . B

.A flatworm has a coelom, but it does not develop from the mesodermal tissues.. . . C. A flatworm has a coelom.. .
Biology
2 answers:
LekaFEV [45]2 years ago
7 0
A. <span>A flatworm doesn't have a coelom

Flatworms and other invertebrates belong to a specific group called </span><span>acoelomate, wherein they lack a coelom and has an internal cavity which serves as their digestive cavity.</span>
Sloan [31]2 years ago
3 0
I think the correct answer among the choices listed above is option A. Flatworms are acoelomates because they do not have a coelom. A coelom is a body cavity in metazoans which is located between the intestinal canal and the body wall.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
How does cardiorespiratory endurance affect physical fitness? It increases the efficiency with which the body delivers oxygen an
vichka [17]
The best answer to the question above would be the first statement. Cardiorespiratory endurance affects physical fitness in such a way that it increases the efficiency with which the body delivers oxygen and nutrients to its cells.
3 0
3 years ago
Read 2 more answers
Which nitrogenous bases are found in dna
lidiya [134]

Answer:

The nitrogenous bases in DNA are adenine (A), guanine (G), thymine (T), and cytosine (C).

Explanation:

8 0
3 years ago
Read 2 more answers
Which of the following is not true about density?
ozzi

Answer:

I THINK THE ANSWER IS... A

Explanation:

Density don’t depend on mass and volume because there are different mass and volumes when it becomes density

3 0
3 years ago
Definition of osmosis
Mrac [35]

a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one, thus equalizing the concentrations on each side of the membran.

4 0
3 years ago
Read 2 more answers
Other questions:
  • how do structures in organisms compare with structures of nonliving things such as construction cranes buildings, ships, airplan
    8·1 answer
  • PLEASE HELP!!!!!!!!<br> How does respiration differ from cellular respiration (breathing)?
    12·1 answer
  • What makes carbon special chemically?
    8·2 answers
  • What is the difference between a base unit and a derived unit
    15·1 answer
  • Plz help me <br> WILL GIVE BRAINLIEST
    8·1 answer
  • What is translation to real life?
    11·1 answer
  • Which structure would be unaffected by the peripheral nervous system?
    5·2 answers
  • Why is it important for the cells produced in meiosis to be haploid?
    8·2 answers
  • What are the uses of cholesterol in animals and their cells?
    10·1 answer
  • Kim's Dalmatian, Tigger, always eats the same brand of food. Although he does everything else at lighting speed, he is a very sl
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!