Answer:
Gluconeogenesis is blocked due to pyruvate dehydrogenase complex inhibition, which starves neurological tissue of glucose.
Explanation:
Metabolism is involved directly or indirectly in all processes conducted in living cells. The brain, popularly viewed as a neuronal–glial complex, gets most of its energy from the oxygen-dependent metabolism of glucose, and the mitochondrial pyruvate dehydrogenase complex (PDC) plays a key regulatory role during the oxidation of glucose. Pyruvate dehydrogenase kinase (also called PDC kinase or PDK) is a kinase that regulates glucose metabolism by switching off PDC. Four isoforms of PDKs with tissue specific activities have been identified. The metabolisms of neurons and glial cells, especially, those of astroglial cells, are interrelated, and these cells function in an integrated fashion. The energetic coupling between neuronal and astroglial cells is essential to meet the energy requirements of the brain in an efficient way. Accumulating evidence suggests that alterations in the PDKs and/or neuron-astroglia metabolic interactions are associated with the development of several neurological disorders. Here, the authors review the results of recent research efforts that have shed light on the functions of PDKs in the nervous system, particularly on neuron-glia metabolic interactions and neuro-metabolic disorders.
Answer: Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.
Explanation:
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The correct answer is A.The climate is changing rapidly but it will be too expensive to fix.
Explanation:
Climate change involves important long-term changes in climate patterns as well as other features on land and bodies of water. This phenomenon has occurred naturally during the history of Earth; however, nowadays climate change has accelerated due to human activities that produce global warming and therefore the increase in temperatures and changes in climate.
Despite this, some deny climate change, which is known as climate change denial; this includes stating climate change does not exist, it is an exaggeration or a hoax, or considering it is the result of natural cycles. According to this, the only statement that is not based on climate change denial is "The climate is changing rapidly but it will be too expensive to fix" because in this statement the speaker recognizes climate change is real and considers it is a serious issue that might be difficult to solve.
Answer:
this is the answer to number 2
Explanation:
the answer is nutrients and energy