2 years ago

What a nucleotide is

2 answers:

6 0

Answer: A nucleotide is an organic molecule that is the building block of DNA and RNA. The nucleotide also have functions related to cell signaling, metabolism, and enzyme reactions

Explanation:

denpristay [2]2 years ago

4 0

Answer:

they are organic molecules consisting of a nucleoside and a phosphate

Explanation:

You might be interested in

Plants can break large rocks into tiny pieces. How is it possible for plants to be able to mechanically weather rocks by breakin

lidiya [134]

Answer:

The roots of the plant grow into the cracks of the rock forcing the rock to break.

Explanation:

Hope this helps

6 0

2 years ago

One of these differentiate grasslands from forests. *

mestny [16]

Answer:

B. High temperatures

Explanation:

the canopy of the forest cover the rest of the forest, so it is cooler

8 0

3 years ago

Read 2 more answers

PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?

Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0

3 years ago

Read 2 more answers

Which of the following products are derived from invertebrates? food shell jewelry silk cottonshell products are derived from in

Elden [556K]

SHELL products are derived from invertebrates.

3 0

3 years ago

Which best describes the sex chromosomes

bija089 [108]

Answer:

UH- wat i.d.k

Explanation:

7 0

3 years ago

Read 2 more answers