1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
7

The division of the nucleus known as

Biology
1 answer:
insens350 [35]3 years ago
5 0

Answer:

mitosis

Explanation:

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
As the nights get longer and the temperatures become colder some plants
vazorg [7]
Some plants cant survive.
8 0
4 years ago
The greek physician hippocrates set ethical standards for doctors. <br> a. True <br> b. False
beks73 [17]
The answer is B.false
3 0
3 years ago
Jealous can spark? <br><br> all of the above<br> passion<br> worry<br> excitement
goblinko [34]

Answer:

All of the above.

Explanation:

Jealousy is the emotional state of feeling jealous. This is more of a negative aspect rather than a positive one, but can also sometimes be a positive aspect in a relationship.

Jealousy incites the person to have negative feelings like anxiousness, wrath, anger, possessiveness, excitement, etc. But it can also lead to an increase in the passionate feelings for the other person, which can make the individual pay more attention to the other person. In this aspect, it becomes a positive thing.

Thus, the correct answer is all of the above.

5 0
3 years ago
Plants using the CAM pathway occur in many locations but are most common in very arid locations, such as deserts. What deserts o
Paladinen [302]

The desert that occurs in North America is the Great Basin Desert and it is located at Nevada of North America.

CAM pathway, which is also called Crassulacean Acid Metabolism, is a pathway that involves carbon fixation that occurs in plants growing in arid areas.

With this pathway these plants are able to photosynthesize during the day, but only exchange gases at night.

An arid habitat is an environment that is characterized by extreme lack of water, example is the desert.

In North America, the desert that occurs there is the Great Basin Desert. It spreads into different states which include:

  • Nevada
  • Western Utah,
  • Eastern California, and
  • Idaho.

But the major part of Nevada is occupied by the Great Basin Desert.

Learn more about CAM pathway here:

brainly.com/question/7061938

6 0
3 years ago
Other questions:
  • What were the first living organisms called on earth
    11·1 answer
  • The temperature at which half of the dna helical structure is lost is called the:
    8·1 answer
  • Under harsh conditions, mycobacterium tuberculosis form what?
    6·1 answer
  • Titanium, a very strong and durable mineral, is used in making bikes, automobile parts, and sports equipment.
    14·1 answer
  • several species of warblers (bird) live in different areas of the same tree . this phenomenon is known as
    14·1 answer
  • Legumes, a type of plant, require Rhizobia, a type of soil bacteria, to survive since these organisms fix nitrogen during photos
    12·2 answers
  • Which best describes what is happening in the area
    11·2 answers
  • What is an arthropod vector​
    6·1 answer
  • Intervention by the federal government is necessary when local environmental policies and actions
    6·2 answers
  • What is the function of the kidneys?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!