You can infer that the birds once had a common ancestor but became separated. Mutations in copying their genes stacked and caused changes in the beaks so the birds could be more well off or better adapted in their new environment.
The answer is yeasts.
Fungi is the kingdom of Eukaryota domain and includes unicellular organisms and multicellular organisms. Y<span>easts are u</span>nicellular fungi. But, some species have an ability to develop some kind of multicellular characteristics such as pseudohyphae that forms by connecting budding cells.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer: c
Explanation: because it helps by excreting
Answer:
Proteins have four levels of organization. Primary structure refers to the linear sequence of the amino acids connected by the peptide bonds. The secondary structure consists of local packing of polypeptide chain into α-helices and β-sheets due to hydrogen bonds between peptide bond – central carbon backbone.
Explanation:
