1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
3 years ago
5

What is speciation?

Biology
2 answers:
Aleksandr-060686 [28]3 years ago
8 0

Answer: The correct answer is -

B.The process by which new species are formed.

Speciation can be described as the process of formation of new species (that are distinct from old species) during the course of evolution of old species.

In other words, when one species gives rise to two or more different species during the course of its evolution, it is termed as speciation.

For example - 13 distinct species of Galapagos finches (bird species), which were formed from single ancestral species due to allopatric speciation (geographical isolation that occured by ocean).

Thus, option B) is the right answer.

statuscvo [17]3 years ago
4 0
B. because specieation is defined as ¨<span>the formation of new and distinct species in the course of evolution.¨</span>
You might be interested in
On a construction site, a worker moves some debris and a bulldozer moves a different pile of debris Which of these best explains
bonufazy [111]

Answer:

The correct answer is - they are both systems that are performing similar functions.

Explanation:

In the given question there are two different entities that do a similar kind of work or perform similar functions, however, the systems are different as one system involves the manpower of a worker whereas the other system involves the high power of a bulldozer.

The work is similar but the amount of the work varies as manual work done by a worker is less in comparison to the bulldozer.

8 0
3 years ago
What is the pristine seas project?
iogann1982 [59]

Answer:

Image result for What is the pristine seas project?

Founded and led by National Geographic Explorer-in-Residence Dr. Enric Sala, Pristine Seas is an exploration, research, and media project aimed at supporting the United Nations' target of 10 percent of the ocean protected by 2020. ... Since its inception, Pristine Seas has carried out expeditions in 23 places.

Explanation:

8 0
3 years ago
How is dna the basic of life?
Allushta [10]


DNA is considered the molecule of life because it contains the instructions that ensure the continuity of life. Employment of DNA to code for protein is the basis of all life on earth. 

In all living things, inherited DNA  is used to code for amino acids  which when joined or linked together in a deliberate specific  manner form polypeptides which make up proteins. These proteins are responsible for  structure and function of cells. 

For example DNA provides information to make  four polypeptide (two beta and two alpha ) chains  which make up hemoglobin, the protein that functions as the oxygen carrier in red blood cells. In summary,

DNA → protein →  trait, and that relationship is the physical basis of life.


6 0
3 years ago
Which glands secrete an oily product that softens the skin and hair?
OverLord2011 [107]
The sebaceous gland
7 0
3 years ago
Read 2 more answers
The energy in ATP is stored in the chemical bond of a(n)( phosphate molecule.
lisov135 [29]

Answer:

I'm pretty sure its Phosphate Molecule

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • a 1 liter jar is filled with water right to the top a rock is then dropped in the jar and 400 ml of water is displaced .what is
    14·1 answer
  • Apply a small amount of heat to 5 grams of water and 5 grams of aluminum. The temperature of the aluminium increases more then t
    5·1 answer
  • Samples of rejuvenated mitochondria are mutated (defective) in 3% of cases. Suppose 18 samples are studied, and they can be cons
    8·1 answer
  • Holly learned from her science teacher that her height resulted from about 180 genes, each contributing a tiny amount of genetic
    11·1 answer
  • Explain why there are different weather and climate patterns at different global locations
    9·1 answer
  • Which is a characteristic of a virus, but NOT a bacterium? A) capsid Eliminate B) causes illness C) damages the cells in a body
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Most genes contain instructions for making ____.
    10·1 answer
  • What kind of cell does the virus attack/damage?
    10·1 answer
  • A sample of DNA contains 120 nucleotides, if 35 nucleotides are Guanine, how many nucleotides are Thymine?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!