1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
10

Worth branliest only if u get it right please answer properly and not just for points it’s the last question for this homework

Biology
2 answers:
serg [7]3 years ago
8 0
Deer is the answer, it is quick and has camouflage
Alexeev081 [22]3 years ago
5 0
Deer is the best answer to your question
You might be interested in
How is fermenation different from cellular respiration
vichka [17]

Answer:

Ok, my first time answering a question!

Explanation:

Normally, your body uses cellular respiration to make ATP.

Cellular respiration needs oxygen to function.

When you exercise or exert yourself, you may begin to run out of oxygen.

Your body then begins fermentation.

Fermentation then makes it so energy can be released from glucose even though oxygen is not available.

Fermentation will also produce ATP, just like cellular respiration.

Hope this helps! :)

5 0
4 years ago
What would happen if cooked potatoes were used in osmosis experiment?
kenny6666 [7]
The potatoes would fill up with water. Osmosis is diffusion but with water. It always moves from the hypotonic (less solute) region to hypertonic (more solute). Good luck!
7 0
3 years ago
Which of the following is an accurate description of what science is? O A Science is a process of observation and experimentatio
Dennis_Churaev [7]

Answer:

Science is a process of observation and experimentation

6 0
3 years ago
(drag and drop) (20 points)
mixas84 [53]

Answer:

Less stable : An ecosystem with populations that mate with only related species

Less stable : An ecosystem that has many species at every trophic level

More stable : An ecosystem with populations that mate with unrelated species

More stable : An ecosystem that has very few species at every trophic level

3 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • What equipment should a food worker use to reheat a baked potato?
    14·2 answers
  • A. a few themes that best describe our behavior.
    13·1 answer
  • Which describes the part of Africa below the Equator
    15·1 answer
  • Which of the following are functions of the respiratory system?
    5·1 answer
  • In fruit flies, an autosomal mutation in the gene for wing veining results in cross veinless wings. This mutation is recessive.
    15·1 answer
  • Cells that contain a full set of chromosomes,or pairs of each chromosomes are?
    7·1 answer
  • Give two<br> reasons why cells divide.
    6·2 answers
  • Which type of neurons keep us informed about what is happening both inside and outside of our bodies?
    8·1 answer
  • Name the protein found in white and yellow fibers
    14·2 answers
  • The disruption of the cell cycle may lead to what
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!