Answer:
Most tissues of the body grow by increasing their cell number, but this growth ... photography of a live plant cell nucleus undergoing mitosis.
Frogs lay eggs under water. When they hatch they are called tadpoles. After a time as tadpoles they undergo metamorphosis where they grow legs and lungs and become the little friendly hippidy hoppidy guys you see on your porch every night.
Graphs show information using visuals and tables use exact numbers. Each way organized data differently, but depending on the question, sometimes one is better than the other..
<span>
</span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The Biblical flood would have caused the death of all life on earth, except for those on the arc, which would have resulted in fossils that are now found. Fossils being found in different layers of rocks could have been a result of how they settled as the waters receded.
