1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
6

Help please thank you so much

Biology
2 answers:
ioda3 years ago
5 0
Answer: A!
Hope it helps :D
andreev551 [17]3 years ago
4 0

Answer:

Initiation is the beginning of transcription. It occurs when the enzyme RNA polymerase binds to a region of a gene called the promoter. This signals the DNA to unwind so the enzyme can ''read'' the bases in one of the DNA strands. The enzyme is now ready to make a strand of mRNA with a complementary sequence of bases.

Explanation:

You might be interested in
Plant and animal cells have which organelle in
Strike441 [17]

Answer:

cell membrane

Explanation:

i took this class last year

7 0
3 years ago
Read 2 more answers
In a scale model of the solar system, if the sun is represented by the ball with a diameter of about 8 inches, how large with th
den301095 [7]
The sun is about 109 times the size of earth, so about 0.073394495412844 inches wide:)
6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which cellular environments is conducive to the formation of disulfide bonds within or between proteins?
Solnce55 [7]

Answer:

The rough ER

Explanation:

Generally the formation of native  disulphide bond is essential for the folding and maturation of  proteins in the secretory pathways.These bonds are formed in the rough E.R, and also in the intramembrane of the mitochondria.

Basically an oxdative parthways is required  for the disulfide bond to form, while a reductive pathway is needed for the formation of isomers for non-native disulphide bonds. These oxidative pathways takes place in the rE.R

Generally the disulphide bonds is usually formed by oxidation of  two cysteines bonds. it does not occur in the cytoplasm because it is always in reduced state due to the presence of disulphide reductase. The same explains why it does not occur in the Nuclei

3 0
2 years ago
Imagine an illness that affects the function of ATP synthase in a human cell. Where is ATP synthase located in a cell? What does
Ludmilka [50]

In eukaryotes, it should be noted that the ATP synthase is located in the inner membrane of mitochondria

<h3>What is ATP synthase?</h3>

The ATP synthase is the mitochondrial enzyme that is localized in the inner membrane, where it catalyzes the synthesis of ATP driven by a flux of protons.

It should be noted that the absence of ADP, the ATP synthase will stop functioning and when this happens, the movement of protons back into the mitochondrion also stops.

The goal of aerobic respiration is simply to derive energy from macromolecules like carbohydrates, proteins, and fats to carry out various energy-requiring processes. Here, the chemical energy is trapped in the form of ATP. It should be noted that aerobic cellular respiration takes place in the cytoplasm and mitochondria.

Learn more about ATP on

brainly.com/question/893601

#SPJ1

7 0
2 years ago
Other questions:
  • E. do the sd, cv, and beta produce the same risk ranking
    15·1 answer
  • What effect does crushing the tablet have on solution rate?
    15·2 answers
  • I need help... I can't do this does anyone know how to do this if so thanks!!
    6·1 answer
  • 1. If a black heterozygous guinea pig is crossed with a homozygous white guinea pig with the
    6·1 answer
  • Suggest why a baby born without any mitochondria will have difficulties growing
    15·1 answer
  • What is the relationship between enzymes and activation?
    10·1 answer
  • Which set of values tells us if the reaction is at equilibrium
    13·1 answer
  • Which statment describes the relationship
    5·1 answer
  • 50 POINTS PLEASE ANSWER ASAP
    14·1 answer
  • What is the name of the Island chain that Darwin explored off the coast of South America?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!