1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
15

Dna codes for a protein by?

Biology
2 answers:
lbvjy [14]3 years ago
7 0
Each protein is coded for by a specific section of DNA called a gene. A gene is the section of DNA required to produce one protein. Genes are typically hundreds or thousands of base pairs in length because they code for proteins made of hundreds or thousands of amino acid
Romashka-Z-Leto [24]3 years ago
5 0

Answer: genes

Explanation:

You might be interested in
Which of the following best describes the scientific idea regarding primordial soup?
bija089 [108]

It refers to the idea the prehistoric oceans combined with lightning formed the building blocks of life.

Explanation:

The primordial soup refers to the idea that prehistoric oceans combined with lightning to form the building blocks of life.

The soup can be regarded as the soup of life through which the first nuclei acids were synthesized.

  • It was a hypothesized set of conditions available when the earth was initially formed about 4.5 billion years ago.
  • The miller-urey experiment was set up in 1930's to demonstrated this soup of life.

Learn more:

Earth brainly.com/question/4545456

#learnwithBrainly

5 0
3 years ago
Which veins lead directly back into the superior and inferior vena cava?
Bess [88]
<span>On the left, they drain into the renal vein which in turn drains into the inferior vena cava. By contrast, all the lumbar veins and hepatic veins usually drain directly into the inferior vena cava.</span>
7 0
3 years ago
Scientists are trying to find the causative agent for a new disease in chicken. They grow a culture of what they think is the ca
Murrr4er [49]
I believe it would be A and D
8 0
3 years ago
The purpose of Metosis is to
Basile [38]

Answer:

Mitosis is a mechanism in which a single cell separates into two separate cells of daughters. One cell in mitosis? Once splits two similar cells into two. Mitosis is primarily aimed at growth and replacement of depleted cells

Explanation:

7 0
3 years ago
Read 2 more answers
Why would this procedure fail to produce a projaryotic cell
slamgirl [31]

Answer:

Explanation:because of trying to produce a damage cell

8 0
3 years ago
Other questions:
  • Illnesses that pass from one organism to another are called _____ diseases.
    15·1 answer
  • Which bone(s) of the human body differ in males and females? label one with a?
    7·1 answer
  • A template dna strand contains the sequence 3'-atgctgac-5'. the corresponding sequence in the rna transcript is:
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Trees produce energy from sunlight. Animals eat tree leaves for energy. This is an example of ____________ . *
    10·1 answer
  • What started the study of the field of genetic engineering?
    7·1 answer
  • PLEASE HELPP (it's due at 11:59, i would like it done now)
    14·1 answer
  • This is for an exam, please help!
    6·1 answer
  • What happens when the livestock
    14·1 answer
  • Three physical forces are involved in glomerular filtration: glomerular capillary blood pressure, plasma-colloid osmotic pressur
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!