1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
8

Can someone please help me with this i will give u extra points + brainliest (:

Biology
1 answer:
antoniya [11.8K]3 years ago
3 0

Answer:

1. There are 4 C (Carbon) atoms, 10 H (Hydrogen) atoms, and 3 O (Oxygen) atoms in the reactants.

2. There are 4 C (Carbon) atoms, 3 O (Oxygen) atoms and 10 H (Hydrogen) atoms in the products.

3. Yes, the equation is balanced.

You might be interested in
Both of the regular intravenous solutions administered in medicine, normal saline and lactated Ringer’s solution, are isotonic
larisa86 [58]

Answer:

Both of the regular intravenous solutions administered in medicine, normal saline and lactated Ringer’s solution, are isotonic. Why is this important?

Explanation:

<em>Because the isotonic saline solution</em> has a sodium concentration similar to that of blood.

ISOTONIC SOLUTIONS: <em>The osmolarity of the isotonic fluid approximates the osmolarity of serum plasma. </em>Isotonic fluids are used to hydrate the intravascular compartment in situations of significant fluid loss, such as dehydration, bleeding, etc.

4 0
3 years ago
How many hydrogen atoms are present in each water molecule? A. 3 B. 2 C. 1 D. 4
jenyasd209 [6]
Hello!

Your answer to this question is
B)  2 hydrogen atoms are present in each water molecule

Hope this help u!!
4 0
3 years ago
Read 2 more answers
4 Which is NOT a part of the eye?<br> A. cochlea<br> B. cornea<br> C. pupil<br> D. retina
kramer

Answer:

A: cochlea

Explanation:

Hopefully this helps!

5 0
3 years ago
Which of the following is the best description of the cane toad’s introduction to Australia?
Zina [86]

Answer:

b.......................

6 0
4 years ago
Definition of photosynthesis written in your own words.
allsm [11]

Answer: when a plant goes through a cycle that takes in carbon dioxide and water in order to create oxygen and makes its own food in order to live

Explanation:

boom *drops mic*

8 0
3 years ago
Other questions:
  • Bacteria and archaea differ in
    7·2 answers
  • Is the temperature profile in the thermosphere more like that of the troposphere or the stratosphere?
    12·1 answer
  • What will happen at the last part after a water-soluble hormone approaches its target cell?
    10·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • The enhancement of contrast at the edge of an object is the result of: lateral inhibition in the retina. the color of the object
    9·1 answer
  • Drag the terms on the left to the appropriate blanks on the right to complete the sentences. not all terms will be used. resethe
    12·1 answer
  • 13. After a candle is blown out, the wax of the candle decreases in temperature. What happens to the molecules of the wax when t
    13·2 answers
  • . A _____________________________________________ key is used to determine the identity of an organism
    10·1 answer
  • Hope these helps, and have a merry christmas
    8·2 answers
  • Compared to many other liquids, water has a high heat of vaporization, which means a relatively large amount of heat must be add
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!