1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
3 years ago
10

Why does catalase function most efficiently at the temperature 22C

Biology
1 answer:
AnnyKZ [126]3 years ago
4 0

Answer

Optimal temperature for catalase activity is around 30'C because the highest amount of oxygen bubbles were observed at this temperature. Catalase activity decreases after optimal temperature. This happens because the enzyme becomes denatured.

You might be interested in
Which of these is a shortcoming of the Clean Water Act? A.) excludes drain pipes B.) excludes lakes, rivers and streams c.) excl
PtichkaEL [24]

Answer: Option C) "excludes agricultural runoff"

Explanation:

The Clean Water Act (CWA) established in 1972 is a federal law made in United States to address the adverse effect of water pollution. The act was aimed to maintain the physical, chemical, and biological integrity of the nation's waters.

A major shortcoming of the Clean Water Act (CWA) is agricultural runoff which is a nonpoint source (NPS) pollution. Large scale agriculture activities have an adverse impact on groundwater and surfacewater as they carry heavy fertilizer, pesticide and  water inputs.

The federal CWA establish water quality standards and total  maximum daily loads (TMDLs) to asses the pollution caused by agricultural water with the help of regulatory mechanisms.

Hence, the correct option C.

6 0
3 years ago
1. What are the main parts of a plant and their functions
mixas84 [53]

Answer:

A leaf consists of three main parts: i) the petiole, ii) leaf base, and iii) lamina or leaf blade. Functions. Making food for the plant with the help of sunlight, carbon dioxide, and water through photosynthesis. Helping in reproduction such as in Bryophyllum, a group of sprout leaf plants.

Explanation:

3 0
3 years ago
BRAINLIESTTT ASAP!!!<br><br> please answer :)
RSB [31]
It looks like the closest match is ATP

6 0
3 years ago
Read 2 more answers
Match each organ with the correct organ system.
elena-s [515]

Answer:

1 stomach- Digestive

2. brain-Nervous

3. heart-Cardiovascular

4. kidneys- excretory

5. bone marrow- lymph

6.Pituitary gland- Endocrine

7. xylem-vascular tissue

8. bones-skeletal

9. Fallopian tubes-Reproductive

Explanation:

7 0
3 years ago
How does the carbon stored in the bodies of living organisms move into rocks?(1 point)
e-lub [12.9K]

In the atmosphere, carbon is stored in the form of gases, such as carbon dioxide. ... This carbon can then be ingested and stored in animals that eat the plants. When the animals die, they decompose, and their remains become sediment, trapping the stored carbon in layers that eventually turn into rock or minerals.

5 0
3 years ago
Read 2 more answers
Other questions:
  • In which tissue system would you find root hairs and the epidermis?
    15·1 answer
  • Cytokines are thought to raise the thermoregulatory set point to cause fever by stimulating the synthesis of which chemical medi
    5·1 answer
  • If you remove the starfish from a shoreline area what happens to the mussel populations
    11·1 answer
  • Explain natural selection and adaptations of bacteria
    6·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which of the following correctly describes the pathway taken by a protein destined for secretion from an animal cell?
    5·2 answers
  • I need five animals that have internal fertilization and five that have external fertilization
    5·2 answers
  • Please help I don't know if it's the right answer
    10·1 answer
  • The complementary base strand to the DNA sequence ATGGCTA is TACCGAT.<br> O True<br> O False
    9·2 answers
  • Why do you think it's important to study past climate to predict future<br> climate?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!