1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
posledela
3 years ago
13

Explain the nursing implications for the client receiving echocardiography with doppler flow studies

Biology
1 answer:
Lelu [443]3 years ago
8 0
<span>Echocardiography with doppler flow can show numerous abnormalities, including ventricular hypertrophy, dilation of heart chambers, and abnormal heart wall motion. Place patient in a supine position on their left side facing the equipment. Instruct the patient about the procedure. Inform the patient about sensations that may occur, like pressure and the mechanical movement from the head of the transducer. There are no contraindications to the procedure.</span>
You might be interested in
What immune system consists of immunity and humoral immunity
Iteru [2.4K]
I hope this helps u.

4 0
3 years ago
Other factors being equal, which sensory stimulus is least likely to lead to sensory adaptation?
valentina_108 [34]
The correct answer is: the wail of a loud car alarm. 
Sensory adaptation is a term that refers to the changes that stimuli can trigger on the sensory receptors. The process involves changes in the receptors' sensitivity and it is believed that all of the senses exhibit this adaptation. In particular, the sense of touch can quickly adapt to hot and cold stimulation, but not when the stimulus is extremely intense (such as too hot or too cold). Also, our olfactory sense presents the characteristic of odour fatigue. A prolonged exposure to a specific smell leads to a temporary inability to sense this smell and this is a type of sensory adaptation. Finally,
our hearing undergoes a sensory adaptation as well, but not when it comes to sudden, unexpected and instantaneous loud noises. That is why the wail of a loud car alarm will be the least likely to cause sensory adaptation.
3 0
3 years ago
Name a land animal that is sessile. Why would this
TEA [102]
Scale insects mature as sessile.
Is a disadvantage because sessile means nonmotile, which means food has to be readily there for them which it's just not bc land animals typically have to keep moving to survive
6 0
3 years ago
Which are specific to just prokaryotes, or just plants, or just animals? drag the appropriate items to their respective bins. he
balu736 [363]
<span>Prokaryotes have magnetite-containing structures, nucleoid (their version of a nucleus), fimbriae. Animals have lysosomes. Plant cells have chloroplasts (make the plant cells green, produce energy for plants), photosynthetic membranes (produce energy for plants), cell well. Flagella can be found in prokaryotes and animal cells but for a simpler biology class, I would put it with prokaryotes.</span>
7 0
3 years ago
Although antacids containing calcium carbonate can increase calcium intake, what effect would excessive consumption of the carbo
nata0808 [166]

Answer:

The blood pH will increase.

Explanation:

Antacids are the chemicals that works against the acids that produced in our stomach. Antacids are generally used to treat the excessive acidity of the stomach.

The intake of excessive carbonate base causes the release of gastric acid secretion in the stomach. Hence, the blood pH increases due to the presence of H + ions in the blood.

Thus, the blood pH will increase.

6 0
3 years ago
Other questions:
  • Which molecule is active first during dna replication?
    8·2 answers
  • What is the first event in human development?
    5·1 answer
  • Because plants can do photosynthesis, they are called _____. because plants can do photosynthesis, they are called _____. hetero
    11·1 answer
  • Is a globe physical model. True or false
    15·1 answer
  • In Mendel's experiment, why did traits show up in the F2 generation that were not present in the F1 generation? A.The traits wer
    11·2 answers
  • Consider the cladogram representing most of the major categories of animals. What physical characteristic is used to divide the
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • 2. In 1988 several large forest fires occurred in
    11·1 answer
  • Why are there lines on the periodic table
    6·2 answers
  • Genetic variation among humans is relatively small when compared to other species. Where in the human genome does most of the di
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!