This causes a disruption in hydrogen bonding. It also causes denaturation and coagulation to the proteins. Hope this helps!
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
c. Visible Light Wave
Explanation:
The electromagnetic radiation spectrum can be divided into seven types of wavelengths of light, which are classified according to the decrease in wavelength and the increase in energy and frequency: 1-radio waves, 2-microwaves, 3-infrared light, 4-visible light, 5-ultraviolet, 6-X rays and 7-gamma rays. The atmosphere is not permissible to all types of wavelengths of light, thereby acting as a natural barrier that protects against harmful radiation waves. All the range of visible light can penetrate the Earth's atmosphere, while most radio waves can penetrate through this barrier. Finally, only some wavelengths of infrared and ultraviolet radiation can pass through the atmosphere.
While protein's primary role is structural, carbohydrates primarily serve as an energy source. In fact, glucose -- one of the simplest carbohydrates -- is your body's preferred energy currency. Whenever your body derives energy from protein because of a low supply in carbs, protein components must undergo a number of biochemical changes to be useful in energy production. Proteins serve above all as your body's building blocks. Every cell needs them for structure, but they also play important roles as molecule transporters, hormones, disease-fighting agents and enzymes Some carbs -- namely fiber -- are important for bowel health and waste elimination.
The fossil record indicates that the earliest hominids most likely originated from the continent of Africa.