Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
There are so many examples for that in different areas, like biology experiment carried out in our lab recently.
Here's one link: https://www.creative-biogene.com/Robust-Tn5-Transposase-EMQZ1422-1271506-26.html
Answer:
away from
Explanation:
<em>Arteries carry blood to tissues</em>
have a nice day and mark me brainliest! :)
A. - A Few Days After Fertilization.
One positive impact of this type of power plant on the environment is that I creates no pollution, unlike other types of power plants like nuclear and fossil fuel.
One negative impact of this type of power plant on the environment is that it could harm fish. As the water hits the turbine, fish that it pulls along also hut the turbine, potentially killing them.
hope this helps !