1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
3 years ago
14

Recent evidence from polar ice core analysis shows that, until now, carbon dioxide levels have never exceeded ________ ppm in th

e last several hundred thousand years.
Biology
1 answer:
kramer3 years ago
6 0

<span>Scientists have been doing several experimentation and discovery of the changes of the ice on the pole. Recent evidence from polar ice core analysis shows that, until now, carbon dioxide levels have never exceeded 300 ppm in the last several hundred thousand years.</span>

You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
What is the source of energy for thermoacidophiles archaebacteria
nikklg [1K]

There are so many examples for that in different areas, like biology experiment carried out in our lab recently.

Here's one link: https://www.creative-biogene.com/Robust-Tn5-Transposase-EMQZ1422-1271506-26.html


6 0
3 years ago
Another question <br> answer please
satela [25.4K]

Answer:

away from

Explanation:

<em>Arteries carry blood to tissues</em>

have a nice day and mark me brainliest! :)

3 0
3 years ago
When does the blastocyst form?
mixer [17]
A. - A Few Days After Fertilization.
7 0
3 years ago
Describe one positive impact of this type of power plant on the environment.
kondaur [170]
One positive impact of this type of power plant on the environment is that I creates no pollution, unlike other types of power plants like nuclear and fossil fuel.

One negative impact of this type of power plant on the environment is that it could harm fish. As the water hits the turbine, fish that it pulls along also hut the turbine, potentially killing them.

hope this helps !
7 0
3 years ago
Other questions:
  • The nontaxonomic term sea slug encompasses a wide variety of marine gastropods. One feature they share as adults is the lack of
    9·1 answer
  • Nina is learning about plants in school. Her teacher gives her group a stack of cards that list things that plants might need to
    14·2 answers
  • There are 206 ________ in the human body.
    14·1 answer
  • Awnser this pls and soon as possible 10 points​
    14·1 answer
  • Does mitosis or meiosis occur more frequently in your body, and can you explain
    15·2 answers
  • Water is referred to as a polar molecule. <br><br> Describe the characteristics of a polar molecule.
    11·1 answer
  • Wildfires are _______.
    11·1 answer
  • PLEASE HELP ASAP ;-;
    14·2 answers
  • What 4 thing do cells have?<br>1. <br>2.<br>3. <br>4.<br><br>2 basic types of cells<br>1. <br>2.​
    11·2 answers
  • Pots A and B both have plain soil, bean seeds, and the same amount of light. Pot B receives more water (see table). After 50 day
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!