Answer:
i believe the answer is d or c sorry if im wrong
Explanation:
u_u
Hydrophytes is the answer to your question
Answer:
A
Explanation:
Plz mark brainliest ᕕ( ᐛ )ᕗ
Answer:
All options are correct
Explanation:
Fossils are the remains of organisms (animals and plants) preserved in a rock. Scientists (geologists & palaebiologists) have used fossils to study the diversity of organisms in the past. This is based on their preserved morphological features. For example, several species of foraminifera has been identified in the rocks. Among them, some species are present today whereas others have become extinct.
Similarly, fossils are the indicators of past climate (e.g. temperature) as well. This means, if a specific species can survive at a particular temperature, its presence suggest that particular environment. For example, corals survive in tropical waters at specific depth and sunlight. So, if we find corals fossils, the cliamte of that particular age would be roughly the similar.
In the end, fossils can also provide evidence of orogeny (mountain building) process. These are typically plants fossils which cannot move and their remains are preserved in the folding rocks.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.