1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krok68 [10]
3 years ago
5

Please help it’s urgent!!!!

Biology
1 answer:
storchak [24]3 years ago
5 0

Answer:

b

Explanation:

You might be interested in
Which is denser, central pacific or arctic ocean?
vladimir1956 [14]

Answer: Arctic Ocean

Explanation:

Because the Arctic Ocean is colder it is more dense

5 0
3 years ago
Kelly, who is blind, switches on the fan in her room without anyone's help. she is able to do this because the ________ relays t
Allisa [31]

Kelly, who is blind, switches on the fan in her room without anyone's help. she is able to do this because the Somatic nervous system relays the relevant information to her brain.

<h3>Nervous system :</h3>

According to the classical doctrine of the nervous system, an animal's nervous system is a highly sophisticated component that coordinates its movements and sensory data by sending and receiving signals to and from various regions of its body.

<h3>Somatic nervous system :</h3>

The somatic nervous system, also known as the voluntary nervous system, is the area of the peripheral nervous system responsible for the voluntary control of skeletal muscle movement.

A part of the peripheral nervous system called the somatic nervous system is responsible for the voluntary control of skeletal muscle movement.

<h3>Example somatic nervous system</h3>

The cranial nerves, which transmit information from the brain to the head and neck region, are an illustration of the somatic nervous system. In this area, conscious motor functions are under the control of the somatic nervous system.

To know more about cranial nerves visit :

brainly.com/question/14084468

#SPJ4

7 0
1 year ago
Can someone plz help me?
Ber [7]

Answer:

C. all living things are made of one or more cells.

Explanation:

Sounds like it.

8 0
2 years ago
Three cells undergo meiosis. How many haploid cells are produced?<br> Ο 3<br> Ο 6<br> Ο 9<br> Ο 12
irakobra [83]

Answer:

the awnser is I believe is 9

6 0
2 years ago
Read 2 more answers
(BRAILIIEST) Can someboody halp me with this
Helen [10]

Answer:

The answer you are looking for is B. The gravitational pull of the moon

Explanation:

The moon influences tides the most. The moon's gravitational pull on the earth is strong enough to tug the oceans into bulge

6 0
3 years ago
Read 2 more answers
Other questions:
  • The process of cell division that creates sex cells in sexually reproducing organisms is called
    12·2 answers
  • Which of the following don't belong to the kingdoms of the Eukaryota domain?
    10·2 answers
  • Explain the role that the skeletal system plays in facilitating cardiovascular system function
    9·1 answer
  • Which of these definitions have been paired with the correct type of cell?
    11·1 answer
  • Which of the following could be a method used to estimate the age of an ancient rock? To find out its mineral composition To fin
    5·2 answers
  • When cells are in a(n) ___<br> solution, they are maintaining homeostasis
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • URGENT HELPPPP!!
    6·2 answers
  • Explain why reintroducing wolves changed the ecosystem of the park? <br> WILL GIVE BRAINLIEST
    6·2 answers
  • I need 2 paragraphs about which is better between organic food or gmo
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!