Answer:
GAAUUGUGGGGACUGAAGCGCGGCAGC
Explanation:
The process whereby a mRNA molecule is formed from a DNA template is called TRANSCRIPTION. The mRNA formation follows the complementary base pairing rule which says that Adenine is bonded to Thymine (Uracil in RNA) i.e A-T(U) while Guanine is bonded to Cytosine i.e. G-C.
Based on this, a DNA molecule with base sequence: CTTAACACCCCTGACTTCGCGCCGTCG will be transcribed into a mRNA strand with base sequence: GAAUUGUGGGGACUGAAGCGCGGCAGC
Answer:
Zhoukoudian
Explanation:
Zhoukoudian can be seen as a cave system which is found in suburban Fangshan District, Beijing in which It has yielded many archaeological discoveries, which include one of the first specimens of Homo erectus , dubbed Peking Man,as well as a fine assemblage of bones of the gigantic hyena Pachycrocuta brevirostris.
The cave was identified as Homo erectus and it said to have more than 10,000 pieces of stoneware, several cinder layers indicating fire use in early man, as well as animal fossils which are from 200 separate species.
Therefore Zhoukoudian is the homo erectus site that provides the longest record of habitation
Answer: HI your question is incomplete but i will provide a general answer that can help you
answer : Permeable Rock layers allow the flow of fluid like substances through them, While Impermeable rock layers do not allow the flow of fluid like substance through them.
Explanation:
Permeable rocks are rocks containing pores through Fluid like substances can penetrate through in the rocks. examples of Permeable rocks are ; Sandstones and Chalk
While an Impermeable rock is a rock that does not allow the flow of fluid like substance through it due to the absence of pores in its rock layers . examples of such rock are ; Clay and marble
Although some permeable rocks might exhibit low level of permeability as well but generally Rock sample with pores are classified as permeable rock layers.
Answer:
Peter's parents genotypes: hh and hh
Peter's possible genotypes: HH or Hh
Gretchen's concern: The legitimacy of Peter's parent is doubtful
Explanation:
Assuming hairy shoulders allele is represented by H and non-hairy shoulder allele by h. H is dominant over h, hence, for someone to have a hairy shoulder, he/she must posses one H allele (Hh or HH).
Peter's parents do not have hairy shoulders, hence their genotypes will be hh and hh.
Peter has hairy shoulder, hence, his genotype is either HH or Hh.
Gretchen is concerned because neither of Peter's parents have hairy shoulder. This means neither of the parents have the hairy shoulder allele (H). The concern of Gretchen would be about the source of Peter's hairy shoulder allele. If neither of the supposed parents have the allele, where did he get his allele from?
The legitimacy of Peter's parents is questionable and this is why Gretchen is concerned.
They are always found in plant foods.
Hope this helps!