1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
3 years ago
11

What is the outer skin called

Biology
2 answers:
Mariulka [41]3 years ago
8 0

Answer: The epidermis is the thin outer layer of the skin.

Explanation:

Zolol [24]3 years ago
4 0

Answer:

Epidermis

Explanation:

The epidermis is the thin outer layer of the skin.

You might be interested in
What is a statement that can be proven by observation or measurement
77julia77 [94]
Quantitive statement.
6 0
2 years ago
Which phrases apply to the formation of tides
tensa zangetsu [6.8K]

Answer:A

Explanation:

This is the answer

3 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
The graph shows how the eccentricity of Earth's orbit increases and decreases in a somewhat predictable pattern. Read
zepelin [54]

Answer:

This cycle takes approximately 100,000 years to complete.

Explanation:

PLATO

3 0
2 years ago
Entifying Structures in the Cell Identify the labeled structures A,B,C​
ollegr [7]

Answer:

A. Golgi apparatus

B. Vacuole

C. Mitochondria

D. Nucleoplasm

E. Cell membrane

Explanation:

3 0
3 years ago
Other questions:
  • Evidence that Earth’s core has a high iron content comes from the study of _____.
    15·2 answers
  • How is lake or river that freezes over helpful to the organisms in the water?
    13·1 answer
  • In the female body, each egg is surrounded by a ____, which breaks open when the egg is mature.
    13·1 answer
  • What is the vocabulary word for a section of dna that codes for a specific protein?
    11·1 answer
  • Pleaseee answer ASAP 15 points if answer
    8·1 answer
  • How are the male penguin trying to attract gloria?
    5·2 answers
  • True or False. To complete a punnett square, you need to know the genotypes of the parent organisms.
    12·1 answer
  • if an earthworm is 18mm long and is photographed and the picture is magnified 2.5x how long will it be in the picture?
    7·1 answer
  • Which is the largest population that an environment can support at any given time?
    10·2 answers
  • RNA differs from DNA by which of the following?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!