1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astra-53 [7]
3 years ago
9

Sophia’s doctor suspected she’s been using marijuana for a long period of time.Which set of symptoms best describe what Sophia’s

doctor observed.
Health
1 answer:
Natali5045456 [20]3 years ago
8 0

Answer:

you didn't list any answer choices so im going to say what i think

Explanation:

red eyes

hallucinations

chill vibes for some and for others hyperness

mental disorders including but not limited to depression, anxiety, weight loss and weight gain

delayed reaction times

poor muscles and limb coordination

You might be interested in
Levi is having chest pains and his doctors are worried about a possible heart attack. Which test will Levi most likely receive?
Ainat [17]
The answer to ur question is EKG
3 0
4 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
An older adult couple with limited means and on Medicare is considering options after the hospitalization of Mrs. A. with a frac
alina1380 [7]

Hi !

Option???

<em> I think home care</em>

3 0
4 years ago
The American public is working toward a smoke free environment? T or F​
Bond [772]
Falseeeeeeeeeeeeeeeeeeee
6 0
3 years ago
Are memories stored in your spinal lobe
Ratling [72]
No
Memories are stored in your temporal lobes.
6 0
3 years ago
Other questions:
  • If you contract a contagious illness from being bitten by a mosquito, what disease is this?
    9·1 answer
  • Are your ears supposed to hurt when you go deep underwater
    5·1 answer
  • When it comes to life insurance premium refers to
    14·2 answers
  • How does a gene mutation happen?
    5·2 answers
  • your friends wants to lose weight around the belly. your friend is planning to do crunches every day to lose the weight.
    12·1 answer
  • Select the correct answer. Which statement about weight control is false? A. Exercise helps people to control their weight by bu
    8·2 answers
  • The cost of the menu includes the cost of food ingredients and the cost of blank and blank
    15·1 answer
  • Mrs. Gregg is a 55-year-old widow who has had an active career as a lawyer. She is an avid reader. She is an independent woman w
    5·1 answer
  • Describe three strategies that can be used to treat contagious infections.
    6·1 answer
  • What health-related physical fitness components should be included in a plan to improve fitness, health, and wellness? There are
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!