1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
3 years ago
5

Why can't Lemon Pickle cannot be stored in an aluminium utensils?​

Biology
2 answers:
Bogdan [553]3 years ago
6 0

Explanation:

Aluminium is a metal from group 13. ... The acids in the pickle would react with aluminium forming hydrogen gas in excess. This will deteriorate the quality and taste of the pickle and would also harm the human body if consumed.

Liula [17]3 years ago
6 0

Answer:

The lemon pickle contains acids. Metals like aluminum readily react with acid to liberate hydrogen gas. This can lead to spoiling of the pickle.

Explanation:

:)

You might be interested in
The area of the continental US most likely to have volcanic activity is the ______________
Marina86 [1]

Answer:

Alaska

Explanation:

Alaska has the most active volcanos in America.  

4 0
2 years ago
Read 2 more answers
Why does catalase function most efficiently at the pH level of 7
Shkiper50 [21]

Answer: Catalase functions the best at the pH of 7 because the pH of 7 is not too acidic or alkaline. It is on the normal scale, like water. Catalase can't be placed in an acidic liquid. It can not be placed in an alkaline liquid either.

Hope this helps!

3 0
3 years ago
What chemical speeds up the process of decomposition when dead organisms are exposed to it?
Kazeer [188]
Oxygen is the primary chemical in the decomposition of organic organisms 

8 0
3 years ago
✧・゚: *✧・゚:* hello *:・゚✧*:・゚✧
In-s [12.5K]

Answer:

c

Explanation:

If you wanted to reduce health risks, why make more?

7 0
3 years ago
A representation of earths rounded surface on a flat surface is called?
Montano1993 [528]
A representation of earths rounded surface on a flat surface is called___a map.
8 0
3 years ago
Other questions:
  • A catalyst for chemical reactions in biological system is called an
    6·2 answers
  • An abiotic factor affecting the behavior and survival of such organisms as robins and violets is the
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Water is a polar molecule, how is it able to cross the plasma membrane?
    7·1 answer
  • Match each description to the level of organization.
    8·1 answer
  • What is the name of the small early planets
    8·1 answer
  • Is a flake of bricks a mechanical or chemical
    13·2 answers
  • How do the small intestines aid in the digestion process?
    10·2 answers
  • What does it mean to say that the U.S. Government has a balanced budget?
    13·1 answer
  • HELP!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!