1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
3 years ago
9

Beatrice, who has type A blood has a baby with type O blood. She accuses Dan, who has type AB blood, of being the father. Can Da

n be the father? ________ Why or why not?
Biology
2 answers:
mixas84 [53]3 years ago
7 0

Answer:

Srry for the language but hell to the no she did the nasty with another man

Explanation:

laila [671]3 years ago
5 0

Answer:

Never it can jot be possible Dan can not be the father of the child

You might be interested in
How are dogs and fish alike
Elanso [62]
They are both Animals ?
3 0
4 years ago
Read 2 more answers
Redbeds are hematite layers between layers of rock. They can indicate the presence of which element in the atmosphere?
densk [106]
Redbeds indicate the presence o iron in the environment. Red beds are red sedimentary rocks and the color is due to the presence of the ferric oxides. Ferric oxides occur as a coating on the sedimentary grains. In between the shale and cherts, iron-rich sediments can be found. 
7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Where is the Kuiper Belt located?
Leona [35]
Answer C it can be found a little past Neptunes orbit
3 0
3 years ago
Imagine a person is in a car accident and suffers a sever physical injury. The
nignag [31]

Answer:

Vein

Explanation:

Veins are the ones that keep you alive because blood goes inside the vein

6 0
3 years ago
Other questions:
  • NEED HELP NOW 100 POINTS 5 pictures to answer WILL MARK BRAINLIEST ANSWER!!!!!!!!! on question 9 and 10 you have to write a writ
    14·2 answers
  • In which organelle does rna perform protein synthesis
    7·1 answer
  • The members of a society? A. Belong to at least two species B. Belong to the same species and interact closely with each other C
    8·1 answer
  • This is the normal nucleotide sequence on a dna strand: A-C-T-G-G-A-T what is a substitution?
    9·2 answers
  • Describe the conservation of mass in a food web
    12·1 answer
  • What  are  the  major  characteristics  of  the  mollusk<br> phylum
    11·1 answer
  • 5. A ________ is wind-powered movement of ocean water over great distances.
    10·1 answer
  • You classified organisms based on anatomical structure and development. Scientists also use DNA to classify organisms. Consideri
    5·1 answer
  • What is the living and the dead ? <br><br>​
    7·1 answer
  • Another group of students carries out a different kind of climate investigation. They interview people who live in parts of Eart
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!