1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
3 years ago
10

1. Which of the following statements about telomeres is

Biology
2 answers:
SashulF [63]3 years ago
7 0
C
Most prokaryotes with circular genome do not have telomeres.
Inessa [10]3 years ago
5 0
The answer is C !!!!!!!!!
You might be interested in
1. How were the scientists able to figure out how many animals there were of each species in
wlad13 [49]

Answer:

More than 35 species of plains animals

Explanation:

In addition to more than 35 species of plains animals, there are some 3,000 lions and great numbers of spotted hyenas, leopards, rhinoceroses, hippopotamuses, giraffes, cheetahs, and baboons.

4 0
2 years ago
Which part of a cell lets things in
VashaNatasha [74]
It would be the nuclear membrane
3 0
2 years ago
Read 2 more answers
Research one way we can protect our water from pollutants
Assoli18 [71]

JBBBBBJBJJAnswer:

Explanation:

BBBABKBJ

4 0
2 years ago
The bases found in the nucleotides of a DNA molecule are<br>&amp;<br>there are chromosomes are​
Tomtit [17]

Answer:

The DNA molecule is a polymer of nucleotides. Each nucleotide is composed of a nitrogenous base, a five-carbon sugar (deoxyribose), and a phosphate group. There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). A DNA molecule is composed of two strands.

4 0
2 years ago
DNA and histones form bread-like globules known as​
Lunna [17]
DNA and Histones Form bread-like globules known as nucleotides
5 0
3 years ago
Other questions:
  • Which of the following are characteristics of living things?
    11·1 answer
  • "an exercise session designed to promote weight loss should expend at least ________ calories."
    14·1 answer
  • Which structure is found mainly in green plants and bacteria?
    6·1 answer
  • The additive effects of growth hormone (gh) and glucocorticoids illustrate the __________
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The condition in which an organism has extra sets of chromosomes is called polyploidy.
    14·1 answer
  • 1. Wind and moving water provide____ energy. A.chemical
    6·1 answer
  • How can foreign pieces of DNA be transferred into organisms?
    15·1 answer
  • How does sexual reproduction reduces the risk of genetic disease?​
    13·2 answers
  • Which of the following is NOT a risk factor for HIV/AIDS?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!