<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Metals are strong, high density, good conductors of heat and electricity, and are also malleable and ductile. While non metals are brittle, dull looking, are poor conductors of heat and electricity, and are overall weaker.
Early season sunlight is needed. Trilliums bloom much earlier during the year <span>to be warmed by the early spring sun.</span>
Answer:
Hominid brain size began to expand rapidly at some point between 800,000 and 200,000 years ago.
Hope this helps :)
Answer:
An inherited medical condition caused by a DNA abnormality
