1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
10

The immune system relies on defensive white blood cells called

Biology
1 answer:
lyudmila [28]3 years ago
3 0

Answer:

I think it is A. Antibodies

Please tell me if I am wrong

You might be interested in
What molecules need to travel<br> through ATP synthase to help it<br> create ATP?
Anna [14]

Answer

Hydrogen ion movement form ATP in ATP synthase .

Explanation:

ATP synthase is present in mitochondrial membrane when pass hydrogen ion in to lumen of mitochondria and due to proton gradient generate ATP molecule with pass of hydrogen ion into lumen ATP is formed from ADP and inorganic phosphorous molecule . Passing of three hydrogen io generate one ATP molecule .So movement of hydrogen ion is directly related to ATP synthases.

3 0
3 years ago
If shells bones and cartilage are usually fossilized what environment might they have lived in before becoming a fossil?
vampirchik [111]

Answer:

Fossils are the preserved remains of plants and animals whose bodies were buried in sediments, such as sand and mud, under ancient seas, lakes and rivers. .

8 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
The human heart is separated into left and right sides. this type of structure provides for the
Evgen [1.6K]
Systematic separation of the circulation of the blood. The right side of the heart receives oxygen-poor blood from your body and pumps it to the lungs. The lungs oxygenate the blood which returns to the heart and is pumped to the rest of the body by the left side of the heart. After which the blood returns to the right side, completing the cycle of circulation.
3 0
3 years ago
Which sentence describes energy flow through a natural (not manufactured) system? 1. A strong wind blows across a Midwestern pra
Ahat [919]
I think the correct answer is 4
4 0
3 years ago
Read 2 more answers
Other questions:
  • Simon is studying a marsh ecosystem that is being altered by purple loosestrife, an invasive species, Simon
    13·1 answer
  • In nature, which pigment gives red algae it's color
    9·1 answer
  • The temperature on a distant planet is measured to be 183 Kelvin by a space probe. This temperature converts to ______ degrees C
    13·1 answer
  • Which feature do all adult echinoderms have?
    6·2 answers
  • Please help!!! Will mark the brainliest!!!!!
    5·1 answer
  • During which stage of aerobic respiration is the most atp made
    13·1 answer
  • A scientist is studying changes in the genetic material that affect the traits of an individual. In which part of the cell must
    11·1 answer
  • Ayuda es urgente...gracias
    11·1 answer
  • An organism with a mutated cell
    6·2 answers
  • 15) naturally occurring variations within a species are mainly the result of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!