1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
barxatty [35]
3 years ago
14

. When an animal is thirsty, it responds by -

Biology
1 answer:
frez [133]3 years ago
6 0

when an animal is thirsty, it responds by drinking water

You might be interested in
What is phylenogeny?
skad [1K]

Answer:

the branch of biology that deals with phylogenesis

Explanation:

another term for phylogenesis

3 0
3 years ago
Read 2 more answers
When your cells go through cellular respiration what is produced from this process?
Gnesinka [82]
<span>When your cells go through cellular respiration what is produced from this process? I think its osmosis. </span><span />
5 0
3 years ago
Each vaccinated child stops transmission of the disease. therefore, as long as _____ percent of the people in a community are im
kogti [31]

Each vaccinated child stops the transmission of the disease. therefore, as long as 90 percent of the people in a community are immunized, no one dies of the disease.

<h3>What is herd immunity?</h3>

The expression herd immunity makes reference to a level of immunization in the population in which people become resistant to the pathogen.

In conclusion, each vaccinated child stops the transmission of the disease. therefore, as long as 90 percent of the people in a community are immunized, no one dies of the disease.

Learn more about herd immunity here:

brainly.com/question/18358089

#SPJ1

5 0
2 years ago
This is for biology thanks
Katarina [22]
Ryfttydejdeexhfldyyldoydyofoyfx
7 0
3 years ago
Read 2 more answers
Question 1 of 10 ________ enhances protein synthesis, decreases glucose use, and promotes the destruction of fats.
FromTheMoon [43]
<span>Growth hormone undertakes all these tactics during lipolysis. In this process, the free fatty acids released by growth hormone become available for uptake by cells, while other fat cells become available for tissues that require their use to produce energy.</span>
7 0
3 years ago
Other questions:
  • • What characteristics are used to classify viruses?
    9·1 answer
  • Is this statement true or false? A spider is an arthropod. Like the other animals in the phylum, it has jointed legs, a segmente
    10·2 answers
  • The portion of the membrane system In eukaryotic cells that is responsible for making liquids and breaking substance is the
    7·1 answer
  • Explain how the nucleus Observed in cheek cell​
    6·2 answers
  • What type of bonds do proteins have
    10·2 answers
  • Respiration releases ____.
    8·1 answer
  • Яке значення партеногенезу?
    11·2 answers
  • Help ASAP!! Timed test/quiz
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Help please! i'm not entirely bad at biology but things like this i don't know lol
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!