1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
8

The spikes on pollen grains probably

Biology
1 answer:
Viefleur [7K]3 years ago
6 0

Answer:

<h3>a) allow pollen grain to stick to insect</h3>
You might be interested in
Nancy and Paul are designing an experiment to measure the amount of honey produced by each of the bee hives they keep. What shou
AleksandrR [38]
What Paul and Nancy should do to ensure a fair comparison between all the hives is to d<span>ocument the number of bees as compared to the amount of honey per hive.
This is the only fair comparison, because they will know approximately how much each of the groups produced compared to the number of bees.
</span>
8 0
3 years ago
Read 2 more answers
How does a streak test help identify different minerals?.
erastovalidia [21]

Answer: determine the color of a mineral in powdered form.

Explanation:

5 0
2 years ago
A man with type O blood and a woman with type AB blood get married. What is the probability that they will have a child with typ
Arte-miy333 [17]

Answer:

b

Explanation:

3 0
3 years ago
Sientific method hypothesis​
Assoli18 [71]
The process of the scientific method involves making conjectures (hypotheses), deriving predictions from them as logical consequences, and then carrying out experiments or empirical observations based on those predictions. A hypothesis is a conjecture, based on knowledge obtained while seeking answers to the question.
6 0
3 years ago
Which scatterplots have clusters? Check all that apply.
Ilia_Sergeevich [38]

Answer:

B and D? or the second and fourth ones

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • For which codon(s) of isoleucine could a single base change account for an amino acid change to methionine?A. AUC B. AUU C. AUA
    12·1 answer
  • What are building blocks of lipids
    5·2 answers
  • que son los halogenos {porfavor nesecito la respuesta resumidad en propias palabras ya que la maestra no quiere que sea la misma
    12·1 answer
  • The amount of toxin needed to poison an animal is often dependent on what factor? weight of the animal time of day the age of th
    9·1 answer
  • What does a virus need to bind to before it can enter host cells
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of the following is the primary employer of natural resource professionals aPrivate landowners b Local governments c Unite
    12·1 answer
  • A balloon is filled with helium in an airplane, where the air pressure is 81 kPa. The filled balloon has volume of 4.2 L. When t
    5·1 answer
  • Evolution is any change in the heritable traits within a
    7·2 answers
  • The centrioles prepare for cell division.<br><br> 1 POINT<br> T<br> True<br> F<br> False
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!