1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
3 years ago
14

10. _________produces pollens and______ develops into the fruit.

Biology
1 answer:
vichka [17]3 years ago
8 0

Answer:

stamen produces pollen ovules develops into fruit

Explanation:

You might be interested in
Can someone help me plz the bus is fixing to come and i need to finish
Shkiper50 [21]

Answer:

B

Explanation:

6 0
3 years ago
How does species diversity vary with (a) latitude in terrestrial communities, (b) ocean depth, and (c) pollution?
Luda [366]

Answer:

It varies greatly...

Explanation:

(a) Latitude is one of the main factors that pushes the evolution toward adaption to a environment. For example, at higher latitude, the diversity is a little low than on lower or average latitude due to the availability of resources that are easily available on ground level relatively.

(b) As we goo deep in ocean, the diversity of life increases as seen in graph but then after a peak point declines rapidly. This is because at normal depth life thrive in normal conditions of temperature and pressure but deep down low, the pressure of water is so intense that it can even crush lead. So, the little amount of organisms that are living in those depths are highly evolved to that intense environment...

(c) Pollution puts a opposite effect on diversity either it is air, water or ground type of pollution. Marine biodiversity take a great loss from chemicals waste as well as the ground animals in which the viable environment gets completely destroyed. This is the main cause of extinction of various animal and plants species.

8 0
4 years ago
Sweat a. is a hypertonic fluid. b. is produced by a merocrine or apocrine gland. c. contains only water. d. reaches the body onl
tangare [24]

Answer:

e. Is not associated with emotions

Explanation:

Sweat is a clear, odourless solution secreted by sweat glands, which are also known as sudoriferous glands. It is hypotonic, meaning that it has a lower concentration of electrolytes than the cells of the sweat glands.

5 0
3 years ago
Based on what Carol's father said, what is the MOST LIKELY reason for Carol's mother having so many cavities as a child?
Tcecarenko [31]

The correct answer would be Fluoride was not used to help protect teeth then

Cavity is not a genetic disease and thus there is no relevance of gene transfer in this case. Thus option A, B and D gets ruled out.

However, flouride in a limited amount is very useful for removing the cavities.  Flouride in the foood and water enters the blood stream and make the teeth strong from inside. While the Flouride in Saliva make the teeths stronger and cavity free from outside. It reduces reminization that causes the loss of minerals.

Thus lack of flouride makes the teeth more cavity prone.

4 0
4 years ago
Read 2 more answers
Which of the following is an example of a scientific model?
vodka [1.7K]
Answer: C. A computer program that simulates atmospheric conditions. 

Scientific models are representations of scientific<span> theories, basically, a hypothesis that is not stated is words, but in computerized programs, visual models, mathematics, and other ways. Hope this helps!</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following can best be attributed to the specific function of enzymes
    13·2 answers
  • Primary pigment molecule needed for photosynthesis is
    7·1 answer
  • What is instantaneous speciation
    5·2 answers
  • Which best matches the description with the genetic material? Nucleotides form a helical structure that is called a gene. Chromo
    12·2 answers
  • Why are soils thin and poor in hot, wet climates?
    13·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Small aquatic organisms, such as coral, are the producers of the ocean.
    15·1 answer
  • At the end of the egg experiment, the egg was placed in water. What type of solution was this?​
    13·1 answer
  • Which of the following molecules are needed for photosynthesis *
    6·2 answers
  • True or false only numbers can be entered in cell
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!