1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
6

You transform a population of cells with a transgene and isolate a cell line that has integrated the gene into its genome, but i

n which the gene is not expressed. Speculate as to what may be preventing the gene from being expressed. Describe two ways to test this possibility.
Biology
1 answer:
Softa [21]3 years ago
8 0

Answer:

The transgene could be silenced by: 1- epigenetic mechanisms (e.g., DNA methylation, histone deacetylation, etc.), and 2-the RNA interference (RNAi) pathway

Explanation:

Epigenetics refers to the heritable changes caused by the activation and deactivation of genes without changing the DNA sequence. Epigenetic mechanisms include 1-DNA methylation on cytosine residues, and 2-modifications on amino acids in the tails of histone proteins (e.g., methylation, acetylation, ribosylation, phosphorylation, etc). These two epigenetic mechanisms can modify DNA structure and thus alter the accessibility of transcription factors, thereby suppressing gene/transgene expression. Moreover, the RNA interference pathway (RNAi) is a naturally occurring mechanism capable of suppressing gene/transgene expression both at transcriptional and post-transcriptional levels. The RNAi mechanism is triggered by regulatory non-coding RNAs (ncRNAs) such as, among others, long non-coding RNAs (lncRNAs) and small ncRNAs (e.g., miRNAs, piRNAs, siRNAs, etc). In this case, for example, DNA methylation on promoter sequences could suppress transgene expression, thereby methods to measure DNA methylation can be used to test this possibility (e.g., bisulfite genomic sequencing). Moreover, miRNAs that bind to the messenger RNA of the transgene could also inhibit its expression by triggering the RNAi pathway (e.g., mRNA degradation), thereby methods to measure mRNA levels can be used to test this possibility (e.g., RT-PCR).

You might be interested in
a man is twice as old as his son.Five years ago the ratio of their ages was 9:4.Find the sum of their ages​
elena-s [515]

Answer:

75years

Explanation:

Let the Father's age be represented by 2x

Let the Son's age be represented by x

Five years ago;

Man's age will be = 2x - 5

Son's age will be = x - 5

If the ratio of their ages five years ago was 9:4, then;

2x - 5/x-5 = 9/4

4(2x - 5) = 9(x - 5)

8x - 20 = 9x - 45

- Collect like terms

-20 + 45 = 9x - 8x

25 = x

Hence, the son's age = 25 years

If x = 25, the father's age (2x) will be 2 × 25 = 50years

The sum of their ages will be = 25years + 50years = 75years

6 0
3 years ago
What chemical involved in the processes of photosynthesis has the greatest number of atoms per molecule? F carbon dioxide G gluc
SOVA2 [1]

Answer: The correct answer is Glucose.

The chemical formula of the given molecules are-

Carbon dioxide is CO₂, which means that it contains 2 oxygen and 1 carbon atom and therefore 3 atoms per molecule.

Glucose- C₆H₁₂O₆, which means that it contains 6 carbon, 12 hydrogen, and 6 oxygen atoms. Thus, total atoms are 24 per molecule.

Oxygen- O₂, which means that it contains 2 atoms of oxygen.

Water- H₂O, which means that it contains 2 hydrogen and 1 oxygen atom and therefore 3 atoms per molecule.

Thus, glucose has greatest number of atoms per molecule.

5 0
3 years ago
What happens to the free energy released as electrons are passed from photosystem ii to photosystem i through a series of electr
wlad13 [49]
<span>The correct answer is: It is used to synthesize ATP through substrate-level phosphorylation.</span>  
<span>The free energy released as electrons are passed from photosystem II to photosystem I drive pumping of H+ and building a gradient. H+ flow down their gradient and when they pass through ATP synthase, the ATP is produced by substrate-level phosphorylation (ADP+Pi).</span>
8 0
3 years ago
Which of the following is an example of catabolism? A. The synthesis of the cell membrane from precursor molecules B. The oxidat
Shtirlitz [24]

Answer:

The correct answer is option B. the oxidation of glucose in the cytoplasm and mitochondria.

Explanation:

The catabolism is the reaction or process that involves breakdown of the larger molecules into smaller molecules. This is the one of the metabolic reaction. Such reactions releases energy.

Oxidation of glucose is a catabolic reaction that involves spliting of glucose into water and oxygen in the respiration.

Thus, the correct answer is option B. the oxidation of glucose in the cytoplasm and mitochondria.

8 0
2 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Which is a consumer? *<br> Grass<br> Tree<br> Snake
    10·1 answer
  • Which type of wave is a secondary wave?<br> body<br> surface<br> transverse<br> subduction
    5·2 answers
  • Energy must be transformed in ecosystems because _______.
    13·2 answers
  • Select the correct statement about the neural mechanisms of respiratory control. A. The ventral respiratory group is contained w
    12·1 answer
  • The intervening age between childhood and puberty​
    12·1 answer
  • What best describes a theory
    12·1 answer
  • What is a substance that cannot be broken down into other substance
    8·2 answers
  • I WILL GIVE A BRAINIEST ANSWER !!
    5·2 answers
  • Identify the inputs and outputs of the muscular<br> system
    6·1 answer
  • How does industrialization primarily result in eustatic sea level change?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!