1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenaWriter [7]
3 years ago
13

One side of section of DNA is shown below. A-G-C-T-T-G-A Which of the following would be the matching side of the section of DNA

?
F A-C-G-T-T-C-T
G T-C-G-A-A-C-T
H A-G-C-T-T-G-A
J C-T-A-G-G-A-G
Biology
1 answer:
lions [1.4K]3 years ago
7 0

Answer:

G) TCGAACT

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Jolanda holds a bottle to her 3-month-old infant's mouth, and the baby reaches out to grab the bottle. Jolanda's baby appears to
Xelga [282]
The answer willl be “two”
8 0
3 years ago
What are the roles of hydrogen peroxide, oxygen, hydrogen, and catalase in the following chemical reaction
olga_2 [115]
Catalase is an enzyme, O2 and H2O are substrates, and H2O2 is a reactant.
Catalase is a substrate, O2 and H2O are substrates, and H2O2 is an enzyme.
Catalase is a substrate, O2 and H2O are products, and H2O2 is an enzyme.
<span>Catalase is an enzyme, O2 and H2O are products, and H2O2 is a substrate.</span>
7 0
3 years ago
What substances are used up as the reactants in cellular respiration?
lana66690 [7]
The cellular respiration happens in the mitochondria. During the cellular respiration, glucose and oxygen are the reactants during this process and the main product of this process is ATP, with waste products carbon dioxide and water. Therefore, the correct answer would be option B. O2 (oxygen) and C6H1206 (glucose).
7 0
3 years ago
Read 2 more answers
Frank counts 56 maple trees living on a 20-acre tract of land, and the data allows him to calculate the
castortr0y [4]

Answer:

Population density.    Population distribution.

Explanation:

8 0
3 years ago
Other questions:
  • The boundary where fresh water feeds into salt water is called a(n) _____.
    13·1 answer
  • Which of these describes a quantitative observation?
    14·1 answer
  • Examine the model of the secretion of a protein into the environment surrounding a cell. Identify and organize the organelles in
    5·2 answers
  • What human activity would most likely decrease the amount of carbon in the atmosphere
    11·1 answer
  • Extra points will give brianliest!!!! IF answered in next 20 mins!
    10·1 answer
  • What happens after pollen lands on the stigma of a flower? A. It grows a tube to travel down to the ovary. B. It fertilizes the
    9·2 answers
  • In organisms blank are encoded in segments of its Chromosomes called blank
    9·1 answer
  • Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? A. single-stranded com
    10·1 answer
  • Study this brochure from NASA, which explains in more detail the instruments carried by the Juno spacecraft.
    12·1 answer
  • Explain how the conversation of wetlands to farmlands has impacted stream and rivers
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!