1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
5

What are 3 positive things human do that impact the environment ?

Biology
1 answer:
Naily [24]3 years ago
4 0

Answer:

Ways in which people positively affect ecosystems around the world include: Recycling. Establishing wildlife preserves and parks. Creating green, open space laws.

Explanation:

:D

You might be interested in
What is the elevation of the X on the topographic map shown below
Julli [10]

Answer:

answer is a 1325 ft

Explanation:

you have to estimate the numbers its rising by 50

so 1200ft first line second Line would be 1250ft and third line is 1300ft.

X is between 1300ft and 1350ft

5 0
3 years ago
which of the following is an obstacle to creating computer based models for tracking hurricanes A. Hurricanes form over water, w
bearhunter [10]
I honestly think D is the anwser
4 0
3 years ago
Read 2 more answers
In genetics, the dash symbol (–) is a "wild card" that stands for either the dominant allele or the recessive allele; for exampl
bearhunter [10]

Answer:

1/16 are ovoid

Explanation:

Hello!

From an AaBb genotype we can obtain four possible gametes AB, Ab, aB and ab.  With the Punnett square we can observe the crossing.  In the second Punnett square we can see the form A– B–

AB          Ab           aB          ab

AB AABB AABb AaBB AaBb

Ab AABb AAbb AaBb Aabb

aB AaBB AaBb aaBB aaBb

ab AaBb Aabb aaBb aabb

AB          Ab          aB          ab

AB A-B-  A-B-  A-B-  A-B-

Ab A-B-  A-bb A-B-        A-bb

aB A-B-  A-B-  aaB- aaB-

ab A-B-  A-bb aaB- aabb

The genotypes of the form A– B–, A– bb and aa B– have triangular seed capsules (15 of 16), while the seed capsules of the aa bb genotypes are ovoid (1 of 16).

Successes with your homework!

3 0
3 years ago
Which of these systems is responsible for removing waste?
Tpy6a [65]

B. Excretory system. Think of it helping things to EXIT your body

7 0
3 years ago
What would be the flow of the water and salt in or out of the plant cells?
ANEK [815]

Answer:

When plant cells are surrounded with salt water, the water inside the plant moves from where there is more water (less salt) through the cell wall and membrane to the outside where there is less water (more salt).

Explanation:

7 0
3 years ago
Other questions:
  • Why is it not correct to say that matthew 23 is anti-semitic?
    7·1 answer
  • Amino acids are the building blocks of which class of macromolecules?
    7·1 answer
  • Answer help points a lot
    9·2 answers
  • list features that are found in eukaryotes but not prokaryotic and their advantages provided by these features
    11·1 answer
  • What term is defined as "the basic unit of structure and functon found in all living thing
    12·1 answer
  • Please help ASAP !! <br><br> punnet squares- biology
    9·1 answer
  • Can anyone Help pleaseeeee!!!
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please hellllpppp!!!! Pleaseee!
    6·1 answer
  • the cytoplasm of a neuron contains many negatively charged proteins, which give the cell a slightly negative charge at rest. wha
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!