1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
2 years ago
13

The graphs here show the distribution of beak depths for the ground

Biology
1 answer:
dedylja [7]2 years ago
5 0

Answer: (A) Natural selection tend to reduce genetic variation as there was a smaller distribution of beak depths, but it tends to select for the most fit phenotypes, as there was an increase in average beak depth after the drought.

Explanation: The picture below shows proof if needed. On USATP

You might be interested in
How do scientists explain the discovery of crinoids in the Wasatch Mountains?
Nostrana [21]
<span>The mountains were once seas. The land was forced up by tectonic motion when the mountains were formed. The Sahara also used to be a sea and has a valley full of the fossilized remains of an extinct species of whale. It is generally agreed upon that two plates colliding caused the uplift that created the mountainous zone. Same for the Himalayas.</span>
6 0
3 years ago
2. Write the molecular formula of following Magnesium Chloride, Sodium chloride, potassium nitrate, hydrogen oxide ​
inna [77]

Explanation:

Magnesium Chloride : MgCl2

Sodium chloride : NaCl

Potassium nitrate : KNO3

Hydrogen oxide : H2O2.

hope this helps you.

5 0
3 years ago
Arrange the rock layers from oldest to youngest re-examine The rock outcrops if you need to. Record the order in the student gui
ira [324]

Answer:

Youngest to Oldest

Shale with ammonite

Limestone with unknown fossil

Basalt

Sandstone with trilobite

3 0
2 years ago
In a mouse, the axis that determines the body pattern from the nose to the tip of the tail is.
svetoff [14.1K]

Answer:

antero-posterior

Explanation:

the axis that determines the body pattern from the nose to the tip of the tail

6 0
2 years ago
If a plant died from lack of food provided by photosynthesis, which structure is most likely missing or damaged
docker41 [41]
I’m pretty sure it would be the leaf
3 0
2 years ago
Other questions:
  • Explain and illustrate how the long-term survival
    6·1 answer
  • Which of the following organisms groups was originally considered an animal by zoologists
    13·1 answer
  • Can you guys name all the koalas species
    14·1 answer
  • In figure 3-1 what process or processes would be occurring in the part of the rock cycle labeled “E”
    14·1 answer
  • What would most likely happen if the amount of phytoplankton in the ocean were reduced?
    12·1 answer
  • Does this change in pulmonary blood pressure increase or decrease capillary filtration in the lungs? Explain.
    9·1 answer
  • CPR, or cardiopulmonary resuscitation, is a first-aid technique to help save lives. It involves compressions of the patient’s ch
    7·1 answer
  • Which statement accurately describes how scientists collect data
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the percent yield of the reaction below if 84.0 grams of Al2O3(s) is recovered from a reaction whose theoretical yield o
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!