1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
3 years ago
6

Describe the changes that happen as a cell differentiates to become a specialised cell

Biology
1 answer:
White raven [17]3 years ago
4 0

Cell differentiation is how generic embryonic cells become specialized cells. This occurs through a process called gene expression. ... During cell differentiation, the cell size and shape changes dramatically, as does its ability to respond to signaling molecules.

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which is not true about plant cell walls?
elena-s [515]
It is B while cell walls do contain cellulose they do not contain hemicellulose
6 0
2 years ago
Which does not describe a cause of the Spanish-American War in 1898? A. Americans believed that the Spanish had sunk the battles
Ira Lisetskai [31]
<span>Spanish authorities in Cuba were accused of atrocities against the people.</span>
6 0
3 years ago
Read 2 more answers
Which of the following statements best describes the nucleus of a cell?
andrezito [222]

Answer:

D

Explanation:

The nucleus is what stores a lot of "data" so to speak or genetic material due to being the command post of the cell.

4 0
3 years ago
Read 2 more answers
How is the information contained in a signaling molecule received by a cell?
Natalija [7]

Answer: Depending on the nature of the signaling molecule, it may either bind to and activate a receptor protein embedded in the plasma membrane, or it may move across the plasma membrane and bind to a receptor protein in the cytoplasm.

Explanation: I found this answer on quizlet

7 0
3 years ago
Read 2 more answers
Other questions:
  • It's a cloudy and rainy day. The air pressure is most likely _____. low, stable, high, increasing
    14·1 answer
  • this yeast population growth data that you are given is an example of which pattern of population growth: exponential and logist
    7·1 answer
  • Red (r) flower color is incompletely dominant to white (r) flower color. which cross will produce 100% pink flowers?
    10·1 answer
  • Based on skin cancer facts, provide a persuasive argument to convince your friend to avoid sunburns
    6·1 answer
  • Eagles-Q
    12·2 answers
  • Why were fungi once classified as plants? What findings led to their reclassification into their own kingdom?
    14·1 answer
  • This biome, with some deciduous trees and an open parkland vegetation type, are transitional between tropical rain forest and gr
    7·1 answer
  • Cholesterol is an important component of animal cell membranes. Cholesterol molecules are often delivered to body cells by the b
    14·2 answers
  • This is part one of the questions i need help on
    15·1 answer
  • What is the basis of modern classification? class 11 biology ​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!