1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
2 years ago
10

HELP CAN SOMEONE FACT CHECK THIS?!?

Biology
1 answer:
IgorLugansk [536]2 years ago
3 0
I think it’s correct
You might be interested in
Roughly how many more atp’s can be produced via the complete aerobic oxidation of glucose compared to that produced by glycolysi
Lubov Fominskaja [6]

Roughly 15 times more ATP can be produced via the complete aerobic oxidation of glucose compared to that produced by glycolysis alone.

<h3>What is Glycolysis?</h3>
  • The metabolic process known as glycolysis turns the sugar glucose (C6H12O6) into pyruvate (CH3COCO2H). The high-energy molecules adenosine triphosphate (ATP) and reduced nicotinamide adenine dinucleotide are created using the free energy released during this process (NADH).
  • A series of ten enzyme-catalyzed processes make up glycolysis. the binding energy of carbs is captured. One metabolic route that doesn't require oxygen is glycolysis (In anaerobic conditions pyruvate is converted to lactic acid).
  • Glycolysis occurs frequently in various species, which suggests that it is an old metabolic route.
  • In fact, the events that makeup glycolysis and its companion process, the pentose phosphate pathway, take place in the oxygen-free environment of the Archean oceans, likewise in the absence of enzymes, and are catalyzed by metal.

To know more about Glycolysis with the given

brainly.com/question/14076989

#SPJ4

8 0
1 year ago
Why might it be beneficial to regulate what species of plats and animals people are allowed to own in particular environments ?
Murljashka [212]
A.) is the correct answer

3 0
3 years ago
Read 2 more answers
Which of the following statements best explains how the Hubble Space Telescope has made outer space exploration easier? It has p
miskamm [114]
<span>It has provided clear and accurate pictures.

</span><span>The statement that best explains how the Hubble Space Telescope has made outer space exploration easier is that it has provided clear and accurate pictures. Particularly, the combination of images helped with detection of some particularly structures and galaxies that were hidden before.</span>
8 0
2 years ago
Read 2 more answers
Plants, algae , and some bacteria use the energy of sunlight in the process of?
Sliva [168]
Photosynthesis.. hope I helped (:
5 0
2 years ago
A person who regularly eats a high-protein diet needs to make sure they _____.
Step2247 [10]

Answer:

I think its a

Explanation:

Adding water is also helping  the body get the rest of nutrions that it needs to function and you need to at least need to add a bit of water in your diet your body

8 0
3 years ago
Other questions:
  • The ____ and the ____ help to support the plant cell and help it maintain its shape.
    7·1 answer
  • when we look at a leaf, we see the colors of light that are reflected off its surface. how does the relatively low flow of oxyge
    8·1 answer
  • An invasive plant that can live in nutrient poor soil moves into an abandoned field. Later this land is cleared of this invasive
    6·1 answer
  • Which must be kept in mind when determining if an explanation is correct?
    12·1 answer
  • According to the cell theory, which describes cells?​
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Mark received one dominant allele for brown hair from his father and another dominant allele from his mother.
    6·1 answer
  • The process of a change in species over long periods of time are called
    13·1 answer
  • Do you think molecules are larger or smaller than a cell in the human body?
    11·1 answer
  • A scientist uses material in her lab to cut a DNA sample into fragments.What process is the scientist using
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!