1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
3 years ago
15

What is DNA and its structure

Biology
2 answers:
jenyasd209 [6]3 years ago
7 0

Answer:

DNA is (deoxyribonucleic acid) Is a self-replicating material. It is present in almost every living organism, as the primary constituent of chromosomes. It is the carrier of genetic organisms.

DNA is made up of molecules that are called nucleotides. Each nucleotide contains a phosphate group(a sugar group and a nitrogen base) The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions(or genetic code)

DaniilM [7]3 years ago
6 0

Answer:

Deoxyribonucleic acid or DNA is a molecule that contains the instructions an organism needs to develop, live and reproduce. These instructions are found inside every cell, and are passed down from parents to their children.

DNA structure --> DNA is made up of molecules called nucleotides.

Explanation:

I hope this helps!  :}

You might be interested in
Viruses change at a very fast rate Can you use this information to explain why vaccines against a specific virus don't last fore
Lorico [155]

Viruses can multiply very quickly, and so they can go through natural selection at a much quicker rate, allowing certain vaccine resistant mutations to take over a population.

7 0
3 years ago
Earth's initial atmosphere probably contained higher levels of water vapor than today's atmosphere. Most of the water vapor left
Elza [17]

The best answer i see is A)- Cooling  

i hope this is right and it helps you

6 0
4 years ago
Read 2 more answers
A human cell is shown in the diagram.
jolli1 [7]

Answer:

Organelle 1

Explanation:

Organelle 1 is the nucleus which stores genetic material such as the xx or xy chromosomes which contain the information for what gender a person is.

3 0
4 years ago
Read 2 more answers
Can someone PLEASE answer these questions QUICKLY
Aneli [31]
1. Radiometric, Relative
2. Radiometric Dating
3. Relative Dating
6 0
3 years ago
bacillus anthracis the bacterium that causes the deadly disease anthrax produces thick endospores what is the significant role o
ElenaW [278]
The significance of the spore formation during the reproductive cycle of the bacterium is that, it provide a defensive strategy against hostile and unfavorable conditions. The spore formation allows the bacterium to reproduce and spread even when the conditions are not favorable. The spore formation also make it possible for the bacterium to remain dormant over a long period of time during unfavorable conditions, waiting for the right conditions to become active again.
5 0
3 years ago
Other questions:
  • Help Please very quick! 40 points!
    15·1 answer
  • Which of the following is a phenotype?<br> Aa<br> heterozygous genes<br> black hair<br> mutated DNA
    8·2 answers
  • Scientists discovered a fossilized cockroach trapped in amber, which was supposed to be about 50 million years old. DNA fingerpr
    9·1 answer
  • Which is the best explanation for how air masses move across the United States
    10·1 answer
  • Sergei Winogradsky Choose one: A. discovered microbial fermentation. B. developed a pure culturing system using agar. C. identif
    11·2 answers
  • Various types of damage can lead to acute inflammation, including cuts and abrasions, heat, and microbial damge. Some microbes h
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Complement proteins and antibodies coat a microorganism and provide binding sites, enabling macrophages and neutrophils to phago
    7·1 answer
  • What all the answer to this image
    5·1 answer
  • What is a phase change that occurs when a gas transition into a liquid?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!